Informations

Comment le site de restriction d'EcoRI a-t-il été séquencé ?

Comment le site de restriction d'EcoRI a-t-il été séquencé ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

La séquence du site de restriction d'EcoRI - GAATTC a été identifiée au début des années 1970, avant l'invention du séquençage de Sanger. (1977)

Comment le site de restriction d'EcoRI a-t-il été séquencé ?


La première détermination d'un site de reconnaissance pour une endonuléase de restriction a été rapportée dans :

Kelly & Smith (1970) Une enzyme de restriction de Hemophilus influenzae II. Séquence de base du site de reconnaissance. J Mol. Biol. 51 : 393-409

L'enzyme était alors appelée endonucléase R, mais est maintenant connue sous le nom de HindII (ou HincII).

La méthode utilisée consistait à couper l'ADN avec l'enzyme, puis à éliminer les phosphates terminaux exposés avec de la phosphatase alcaline. Ces extrémités pourraient alors être étiquetées avec 32P en utilisant une polynucléotide kinase et de l'ATP marqué au .

L'ADN marqué aux extrémités a ensuite été traité avec des nucléases de trois manières différentes pour libérer des mononucléotides, des dinucléotides et un mélange enrichi en trinucléotides. Dans chaque cas, les produits marqués ont été identifiés par leur comportement en chromatographie sur couche mince 2D et ont été caractérisés en outre pour leur composition totale en bases après digestion en mononucléotides, le cas échéant.

Le site déduit était/est

5'----GTY RAC----3' 3'----VOITURE YTG----5'

Ainsi, les mononucléotides marqués se sont avérés être A et G (purine = R), les dinucléotides se sont avérés être GA et AA et ainsi de suite.

La séquence EcoRI a été déterminée essentiellement par la même méthodologie et a été rapportée par

Hedgpeth et al (1972) Séquence nucléotidique d'ADN restreinte par l'endonucléase RI. Proc. Natl. Acad. Sci États-Unis 69:3448 - 3452

Addenda:

Bien que le séquençage de Sanger (la méthode plus-moins) ait pu être développé dans les années 1970, il n'a vraiment fait son chemin qu'au début des années 80. Ainsi, par exemple, la première séquence plasmidique complète à déterminer était pBR322 en 1979 :

Sutcliffe (1979) Séquence nucléotidique complète du plasmide Escherichia coli pBR322. CSH Symp. Quant. Biol. 43 : 77 - 90

"J'ai déterminé la séquence de 4362 paires de nucléotides du vecteur de clonage plasmidique pBR322 en utilisant la technique de séquençage de l'ADN de Maxam et Gilbert (1977). La structure de l'ADN présente plusieurs caractéristiques intéressantes qui conduisent à des prédictions testables."

La méthode de séquençage standard utilisée à cette époque était le séquençage chimique utilisant la méthodologie Maxam-Gilbert. Lorsque j'ai commencé un post-doctorat aux États-Unis en 1979, le séquençage M-G était la méthode standard. Le séquençage de Sanger n'a vraiment décollé qu'après le développement des vecteurs M13 mp (et plus tard des plasmides pUC) par J Messing au début des années 80. Et quel soulagement : le séquençage M-G était extrêmement laborieux, comme en témoignera tous ceux qui l'ont fait.


ÉcoIR

ÉcoIR (prononcé "eco R one") est une enzyme endonucléase de restriction isolée d'espèces E. coli. C'est une enzyme de restriction qui clive les doubles hélices d'ADN en fragments à des sites spécifiques, et fait également partie du système de modification de restriction. Les Éco une partie du nom de l'enzyme provient de l'espèce à partir de laquelle elle a été isolée - "E" désigne le nom générique qui est "Escherichia" et "co" désigne le nom de l'espèce, "coli" - tandis que le R représente la souche particulière, dans ce cas RY13 , et le I indique qu'il s'agissait de la première enzyme isolée de cette souche.

En biologie moléculaire, il est utilisé comme enzyme de restriction. ÉcoRI crée des extrémités cohésives de 4 nucléotides avec des surplombs d'extrémité 5' d'AATT. La séquence de reconnaissance d'acide nucléique où l'enzyme coupe est G↓AATTC, qui a une séquence palindromique complémentaire de CTTAA↓G. D'autres enzymes de restriction, en fonction de leurs sites de coupure, peuvent également laisser des surplombs 3' ou des extrémités franches sans surplombs.


Les enzymes de restriction

L'ADN peut être coupé par endonucléases de restriction ( ). Les endonucléases sont des enzymes capables d'hydrolyser le polymère d'acide nucléique en brisant le phosphodiester liaison entre le phosphate et le pentose sur le squelette d'acide nucléique. Il s'agit d'une liaison covalente très forte tandis que les liaisons hydrogène plus faibles maintiennent leurs interactions et leur double brin.

Comme leur nom l'indique, les endonucléases de restriction (ou enzymes de restriction) sont "limité” dans leur capacité à couper ou à digérer l'ADN. La restriction utile aux biologistes est généralement palindrome séquences d'ADN. Les séquences palindromiques sont la même séquence en avant et en arrière. Quelques exemples de palindromes : RACE CAR, CIVIC, A MAN A PLAN A CANAL PANAMA. En ce qui concerne l'ADN, il y a 2 brins qui sont antiparallèles l'un à l'autre. Par conséquent, le complément inverse d'un brin est identique à l'autre. Les biologistes moléculaires ont également tendance à utiliser ces ciseaux moléculaires spéciaux qui reconnaissent les palindromes de 6 ou 8. En utilisant des couteaux 6 ou 8, les séquences se produisent rarement sur de grandes étendues, mais assez souvent pour être utiles.

EcoRI génère des extrémités collantes et cohésives SmaI génère des pointes émoussées

Les enzymes de restriction hydrolysent les liaisons phosphodiester covalentes de l'ADN pour laisser soit des extrémités «collantes/cohésives» soit des extrémités «émoussées». Cette distinction dans la coupe est importante car un EcoRI L'extrémité collante peut être utilisée pour faire correspondre un morceau d'ADN coupé avec la même enzyme afin de les coller ou de les ligaturer ensemble. Alors que les endonucléases coupent l'ADN, ligases les réunir à nouveau. ADN digéré avec EcoRI peut être ligaturé avec un autre morceau d'ADN digéré avec EcoRI, mais pas à un morceau digéré avec SmaI. Un autre couteau émoussé est EcoRV avec une séquence de reconnaissance de GAT | ATC.


Application des endonucléases de restriction HindIII et EcoRI dans l'identification et le diagnostic de la mucoviscidose causée par la mutation CFTR F508

La mucoviscidose (FK) est causée par une mutation sur la protéine CFTR empêchant le transport des sels à travers les surfaces des cellules épithéliales conduisant à une hyperproduction de mucus et éventuellement à la mort. Le but de cette expérience était de déterminer si un patient de 3 ans est atteint de mucoviscidose. L'hypothèse stipulait que Jeff aurait la mucoviscidose causée par la mutation CFTR ∆F508. Il a été prédit que l'ADN de Jeff et les contrôles positifs/négatifs seraient coupés par EcoRI deux fois produisant trois bandes avec les tailles 2 150 pb, 2 150 pb et 4 700 pb et que l'ADN de Jeff et le contrôle positif seraient coupés par HindIII une fois produisant deux bandes avec les tailles 7 200 pb et 1 800 pb. L'expérience a utilisé les endonucléases de restriction EcoRI et HindIII dans l'analyse RFLP et a visualisé les résultats par électrophorèse sur gel d'agarose, la taille moléculaire de ces fragments d'ADN a été calculée à partir d'une équation produite à partir d'un graphique de courbe standard. L'ADN d'un patient avec la mutation CFTR F508 a été inclus comme contrôle positif et l'ADN d'un patient sans la mutation CFTR ∆F508 a été inclus comme contrôle négatif. Les résultats de l'expérience ont montré que tous les échantillons d'ADN coupés par EcoRI produisaient des fragments d'ADN de taille similaire, et l'ADN de Jeff et le contrôle positif étaient coupés presque à l'identique par HindIII, tandis que le contrôle négatif était coupé différemment. Ces résultats ont conduit à l'acceptation de l'hypothèse, ce qui signifie que Jeff a été diagnostiqué avec la mucoviscidose causée par la mutation CFTR ∆F508.

Introduction

Chez les individus en bonne santé, le corps réagit aux infections respiratoires en augmentant les niveaux de mucus dans les poumons et les voies respiratoires. Cependant, ce mucus peut également piéger des bactéries et des corps étrangers, de sorte que la protéine de régulation de la conductance transmembranaire de la mucoviscidose (CFTR) transporte des sels, notamment des ions chlore, des ions bicarbonate et des anions à travers les cellules pulmonaires épithéliales pour hydrater les poumons et éliminer l'excès de mucus (Gentzsch, 2018 Sud et al. 2018).

Cependant, il existe plus de 2000 mutations du gène CFTR qui peuvent entraîner la maladie mortelle de la fibrose kystique (Southern et al. 2018). Ces mutations CFTR sont regroupées en cinq classes différentes en fonction de la façon dont elles affectent la protéine CFTR : les mutations de classe I produisent une protéine CFTR dysfonctionnelle en ajoutant un codon d'arrêt précoce à la séquence génétique, les mutations de classe II produisent une protéine CFTR anormale dont la plupart est dégradée. par la cellule avant qu'elle n'atteigne la muqueuse pulmonaire, les mutations de classe III produisent des protéines CFTR qui ne peuvent pas transporter les ions à travers les cellules pulmonaires épithéliales, les mutations de classe IV produisent des protéines CFTR altérées qui ont du mal à transporter les ions à travers les cellules pulmonaires épithéliales, les mutations de classe V produisent un Protéine CFTR mais en nombre inférieur à la normale, ce qui réduit son efficacité (Southern et al. 2018).

La plus courante des mutations CFTR, responsable de 90 % des cas de mucoviscidose (Cooney, 2018) est un défaut de classe II appelé mutation ∆F508, cette mutation spécifique se produit lorsque la phénylalanine est supprimée en position 508 du gène CFTR (Suaud et al. 2011). Il s'agit d'une maladie autosomique récessive très courante et mortelle qui affecte 1 Nord-Américain sur 2 000 ou 70 000 personnes dans le monde (Cutting, 2015 Southern et al. 2018). Cette maladie est mortelle en raison d'une protéine CFTR dysfonctionnelle, ce qui signifie que le mucus s'accumule dans les poumons et les canaux pancréatiques qui piège les bactéries, affaiblit le système immunitaire, endommage les organes, provoque une inflammation et conduit souvent au diabète et/ou à la malnutrition, généralement les patients. meurent d'insuffisance respiratoire (Cutting, 2015 Southern et al. 2018). Heureusement, il existe plusieurs traitements pour atténuer les effets de cette maladie et prolonger la vie des personnes touchées, et comme la mucoviscidose n'est causée que par des mutations du gène CFTR, il est relativement facile de tester et de diagnostiquer les patients (Cutting, 2015).

Ces troubles autosomiques récessifs monogéniques (Cutting, 2015) créent un type de variation génétique du gène CFTR au sein d'une population appelée polymorphisme (Pare, 2012). L'un des moyens les plus courants pour diagnostiquer les polymorphismes à mutation unique est d'utiliser une technique appelée analyse du polymorphisme de longueur des fragments de restriction (RFLP), qui utilise des endonucléases de restriction pour couper les séquences d'ADN en fragments sur des sites spécifiques afin d'aider les chercheurs à identifier les variations génétiques (Loenen et al. 2014 Sapienza, 2012). Les endonucléases de restriction sont des enzymes naturellement produites chez plusieurs espèces de procaryotes, mais qui ont de nombreuses applications dans les expériences génétiques en laboratoire (Pingoud et al. 2014). Les endonucléases de restriction ou REases sont regroupées en quatre catégories (Type I, Type II, Type III et Type IV). , ce processus produit des fragments d'ADN cohérents (Pingoud et al. 2014 Sapienza, 2012).

Deux des REases de type II les mieux comprises comprennent EcoRI et HindIII : EcoRI qui a été découvert à partir d'Escherichia coli et HindIII a été découvert à partir de Haemophilus influenzae rd (Pingoud et al. 2014). Plus précisément, EcoRI et HindIII localisent leurs séquences de reconnaissance de nucléotides décalées spécifiques et clivent les liaisons phosphate entre les nucléotides : EcoRI reconnaît GAATTC et clive la liaison phosphate entre le G et A, en outre, il reconnaîtra et coupera toutes les séquences qui diffèrent d'une base. paire, HindIII reconnaît AAGCTT et clive la liaison phosphate entre les deux A (Loenen et al. 2014 Sapienza, 2012). De plus, étant donné que ces deux REases produisent des coupes décalées symétriques, les fragments d'ADN peuvent s'hybrider à leur brin complémentaire, ce qui a été exploité pour des applications de clonage génétique (Loenen et al. 2014). Lorsqu'EcoRI est ajouté à l'échantillon d'ADN de sang ou de salive d'un patient avec ou sans la mutation CF∆F508, l'EcoRI clive le gène CFTR deux fois pour produire trois fragments de 2 150 pb, 2 150 pb et 4 700 pb. Cependant, HindIII produit des résultats différents lorsqu'il est ajouté à l'échantillon d'ADN de sang ou de salvia de patients avec et sans mutation CF∆F508. Chez les patients sans la mutation CF∆F508, HindIII clive le gène CFTR deux fois pour produire trois fragments de 1 500 pb, 5 700 pb et 1 800 pb. D'autre part, chez les patients porteurs de la mutation CF∆F508, HindIII n'identifie pas la séquence de reconnaissance à 1 500 pb car la délétion de la phénylalanine à la position 508 perturbe le reste de la séquence, donc à la place HindIII clive le gène CFTR uniquement pour produire deux fragments de 7 200 pb et 1 800 pb. La raison pour laquelle HindIII produit des résultats différents chez les patients avec et sans mutation, tandis qu'EcoRI produit des résultats identiques, est que HindIII est plus spécifique et ne peut identifier que des séquences de reconnaissance exactes alors qu'EcoRI est légèrement moins spécifique et peut identifier des séquences légèrement variées. Les résultats de l'analyse RFLP peuvent être analysés par électrophorèse sur gel d'agarose, un colorant fluorescent est ajouté aux échantillons d'ADN afin qu'il soit fluorescent sous un transilluminateur UV pour révéler la distance parcourue par les fragments. La distance parcourue par les échantillons est proportionnelle à leur longueur. Par conséquent, les distances parcourues par les fragments d'ADN marqueurs peuvent être utilisées pour créer une équation à partir d'une courbe standard qui utilisera les distances parcourues par les autres échantillons d'ADN pour déterminer leur taille moléculaire.

Cette expérience va tester un enfant de 3 ans adopté nommé Jeff pour la mucoviscidose causée par la mutation CFTR ∆F508. Pour déterminer si Jeff est atteint de mucoviscidose, son ADN sera soumis à une analyse RFLP avec les endonucléases de restriction EcoRI et HindIII. Un contrôle positif (patient avec la mutation F508) et un contrôle négatif (patient sans la mutation ∆F508) subiront également une analyse RFLP avec EcoRI et HindIII afin que les résultats de Jeff puissent être comparés à quelque chose. Les résultats de l'analyse RFLP seront visualisés par électrophorèse sur gel d'agarose puis l'équation produite à partir d'une courbe standard sera utilisée pour calculer les tailles moléculaires des fragments d'ADN après leur coupe par les REases. Il est important de déterminer si Jeff est atteint de mucoviscidose et de quel type de mutation sa mucoviscidose est causée afin qu'il puisse recevoir le meilleur traitement afin qu'il puisse vivre une vie sans douleur et prolongée.

On suppose que Jeff est atteint de fibrose kystique parce qu'il présente plusieurs des symptômes associés à la fibrose kystique, notamment une respiration sifflante, des crépitements, une toux persistante, des selles graisseuses et un écoulement nasal. De plus, comme la mucoviscidose causée par une mutation CFTR F508 est une maladie autosomique récessive, il est possible que ses deux parents soient porteurs de la mutation et qu'il ait hérité de deux allèles mutés, cela explique pourquoi ses parents n'auraient pas d'antécédents médicaux de kyste. fibrose.

Si cette hypothèse est correcte et que Jeff est atteint de mucoviscidose causée par la mutation CFTR F508, alors il est prédit que lorsque son ADN sera coupé par EcoRI deux fois pour produire trois bandes qui ont des poids moléculaires de 2 150 pb, 2 150 pb et 4 700 pb et que son ADN sera coupé une fois par HindIII pour produire deux bandes ayant des poids moléculaires de 7 200 pb et 1 800 pb. De plus, les contrôles (patients avec et sans la mutation ∆F508) seront également coupés par EcoRI deux fois pour produire trois bandes ayant des poids moléculaires de 2 150 pb, 2 150 pb et 4 700 pb. Par conséquent, l'ADN de Jeff et les patients avec et sans la mutation ∆F508 auront des bandes de poids moléculaires identiques lorsqu'ils seront coupés par EcoRI. De plus, le contrôle positif (patient avec la mutation ∆F508) sera également coupé par HindIII une fois pour produire deux bandes qui ont des poids moléculaires de 7 200 pb et 1 800 pb. Alors que le contrôle négatif (patient sans la mutation ∆F508) sera coupé deux fois pour produire trois bandes ayant des poids moléculaires de 5 700 pb, 1 800 pb et 1 500 pb. Cela signifie que les bandes qui apparaissent lorsque l'échantillon d'ADN de Jeff est coupé avec HindIII doivent être identiques en poids à celui du patient avec la mutation ∆F508 dont l'ADN a également été coupé avec HindIII, et ces deux échantillons doivent être différents que lorsque HindIII est utilisé avec le patient qui n'a pas la mutation ∆F508.

Matériaux

Pour commencer, six échantillons d'ADN ont été obtenus : deux échantillons du patient testé pour la mucoviscidose (Jeff), deux échantillons d'un individu porteur de la mutation ∆F508 et deux échantillons d'un individu sans mutation F508. Les échantillons de l'individu avec la mutation ∆F508 avaient été préalablement coupés avec EcoRI et HindIII respectivement, rien d'autre n'a été ajouté à ces échantillons jusqu'à ce que le colorant de charge soit ajouté. Le tampon de réaction a été combiné avec les autres échantillons, puis EcoRI a été ajouté à un échantillon d'ADN de l'individu sans la mutation ∆F508 et à l'un des échantillons d'ADN de Jeff. Ensuite, HindIII a été ajouté à un échantillon d'ADN de l'individu sans la mutation ∆F508 et à l'un des échantillons d'ADN de Jeff. Ces quatre échantillons ont été incubés à 37 degrés Celsius pendant trente minutes. Une solution de gel d'agarose à 0,8 % a été préparée avec de l'agarose, 1x tampon TAE et 10 000x de colorant de gel d'ADN Sybr Safe. Cette solution a été versée dans un plateau de gel verrouillé dans un rack de coulée, un peigne a été ajouté puis le gel a été placé au réfrigérateur pendant trente minutes pour se solidifier. Le peigne a été retiré, puis le plateau de gel avec le gel solide a été déposé dans la chambre d'électrophorèse et immergé dans un tampon 1x TAE. Un colorant de charge contenant du Ficol a été ajouté à chacun des six échantillons d'ADN. Un marqueur a été chargé dans le premier puits/piste pour afficher les bandes des tailles moléculaires suivantes : 12 000 pb, 7 000 pb, 3 000 pb, 2 500 pb, 2 000 pb, 1 800 pb et 1 500 pb. Ensuite, les six échantillons d'ADN qui avaient été coupés avec EcoRI ou HindIII ont été chargés dans des puits séparés. Le couvercle a été placé sur la chambre d'électrophorèse de manière à ce que la charge passe du négatif au positif, l'appareil a été laissé fonctionner pendant 45 minutes à 120 V jusqu'à la moitié du gel. Le gel a été retiré de l'appareil et visualisé sur le transilluminateur UV à côté d'une règle afin que la distance parcourue par chaque colorant puisse être mesurée. Un graphique de courbe standard a été créé avec les données des mesures du marqueur. L'équation générée par ce graphique a été utilisée pour approximer la taille moléculaire des bandes des six échantillons d'ADN. (DeCicco-Skinner, 2019).

Résultats

Figure 1 : Affichage du gel au-dessus du transilluminateur UV à côté d'une règle métrique. La piste 1 contenait le marqueur et produisait 7 bandes visibles, la piste 2 contenait -E (ADN du patient sans la mutation F508, coupé avec EcoRI), la piste 3 contenait +E (ADN du patient avec la mutation ∆F508, coupé avec EcoRI), la piste 4 contenait JE (ADN de Jeff coupé avec EcoRI), la piste 5 contenait -H (ADN du patient sans la mutation ∆F508, coupé avec HindIII), la piste 6 contenait +H (ADN du patient avec le ∆F508 mutation, coupé avec HindIII), la piste 7 contenait JH (ADN de Jeff coupé avec HindIII). Les pistes 2, 3 et 4 ont chacune produit deux bandes presque identiques dans les trois puits. Lane 5 a produit quatre groupes. Les pistes 6 et 7 ont produit deux bandes presque identiques.

La distance parcourue par les bandes sur le gel a été mesurée à partir de la distance entre le puits et le fond de la bande. Le marqueur de la piste 1 contenait des bandes de plusieurs poids moléculaires : la bande de 12 000 pb a parcouru 21,5 mm, la bande de 7 000 pb a parcouru 26,5 mm, la bande de 3 000 pb a parcouru 29,2 mm, la bande de 2 500 pb a parcouru 34,4 mm, la bande de 2 000 pb a parcouru 37,9 mm, la bande de 1 800 pb a parcouru 40,5 mm et la bande de 1 500 pb a parcouru 44,1 mm (Figure 1). La piste 2 a été chargée avec l'ADN du patient sans la mutation ∆F508 qui a été coupée avec EcoRI, la piste 2 affichait deux bandes : l'une parcourait 28,1 mm et l'autre parcourait 35,2 mm (Figure 1).La piste 3 a été chargée avec l'ADN du patient avec la mutation ∆F508 qui a été coupé avec EcoRI, la piste 3 avait également deux bandes : l'une parcourait 27,8 mm et l'autre 36,1 mm (Figure 1). La piste 4 était chargée avec l'ADN de Jeff et avait été coupée avec EcoRI, la piste 4 avait également deux bandes presque au même endroit que les deux puits précédents : une bande a parcouru 28,0 mm et l'autre a parcouru 35,9 mm (Figure 1). La piste 5 a été chargée avec l'ADN du patient sans la mutation ∆F508 qui a été coupée avec HindIII, la piste 5 avait quatre bandes voyageant 27,8 mm, 35,8 mm, 42,3 mm et 44,1 mm (Figure 1). La piste 6 a été chargée avec l'ADN du patient avec la mutation ∆F508 qui a été coupé avec HindIII, la piste 6 avait deux bandes voyageant 26,1 mm et 43,5 mm (Figure 1). La piste 7 était chargée avec l'ADN de Jeff et avait été coupée avec HindIII, la piste 7 avait deux bandes très similaires à la piste 6, parcourant 26,0 mm et 43,5 mm (Figure 1).

Figure 2 : Affichage de la courbe standard pour la digestion par restriction de mutation CFTR ∆F508. Le log du poids moléculaire de chaque bande de marqueur a été tracé sur l'axe des y, et la distance en millimètres à laquelle chaque bande a migré depuis le puits dans lequel le marqueur a été chargé a été tracée sur l'axe des x. À partir de ces données, une ligne de tendance linéaire a été ajoutée, l'équation de la ligne de meilleur ajustement a été calculée et affichée (y=-0,0391x + 4,8133), et le coefficient de détermination a été calculé et affiché (R^2=0,8987).

Les mesures collectées à partir de la figure 1 ont été utilisées pour créer le graphique de la courbe standard de la figure 2. L'ajout d'une ligne de tendance linéaire a produit une équation de la ligne de meilleur ajustement (y = -0,0391x + 4,8133) et a donné un coefficient de détermination de 0,8987 . La distance parcourue par chaque bande pour les six échantillons a été insérée dans cette équation, puis l'antilog a été pris pour calculer la taille approximative de la bande.

Tableau 1 : Résultats de digestion par restriction de la mutation CFTR F508 par EcoRI et HindIII pour Jeff, patient avec la mutation CFTR F508 et patient sans la mutation CFTR ∆F508.
Tableau 1 : Affichage du poids moléculaire attendu vs observé pour le marqueur et six échantillons d'ADN coupés avec EcoRI ou HindIII. Le poids moléculaire de chaque échantillon a été calculé à partir de l'équation de la courbe standard (y=-0,0391x + 4,8133). Les pistes 2, 3 et 4 avaient des bandes de tailles très similaires et les valeurs étaient proches de ce qui était attendu. Lane 5 avait plus de bandes que prévu. Les pistes 6 et 7 avaient des bandes très similaires et proches de ce qui était attendu.

A partir de l'équation de la figure 2, les tailles de bandes observées ont été calculées pour les six échantillons d'ADN et enregistrées dans le tableau 1. Les tailles de bandes observées ont également été calculées pour le marqueur afin que la quantité d'erreur puisse être quantifiée. Le tableau 1 montre que le poids moléculaire calculé est différent du poids moléculaire attendu, cette différence est plus notable lorsque la bande a plus de paires de bases. Cela signifie que la taille de bande observée pour les échantillons d'ADN ne doit pas correspondre exactement à la taille de bande attendue et que la valeur sera plus précise pour les bandes avec moins de paires de bases. Pour les trois échantillons d'ADN coupés avec EcoRI (les patients avec (+E) et sans (-E) la mutation CFTR F508, et Jeff (JE)), il était prévu que l'EcoRI couperait le brin d'ADN deux fois pour produire trois bandes : deux bandes de 2 150 pb et une bande de 4 700 pb. Cependant, l'observation de ces échantillons n'a révélé que deux bandes. Le patient -E avait des bandes calculées de 2 500 pb et 5 183 pb le patient +E avait des bandes calculées de 2 522 pb et le patient JE avait des bandes calculées de 2 568 pb et 5 229 pb. Ces valeurs sont très proches et sont essentiellement identiques. Le patient sans la mutation CFTR ΔF508 (-H) dont l'ADN a été coupé avec HindIII devait être coupé deux fois pour produire trois bandes : 1 500 pb, 5 700 pb et 1 800 pb. Cependant, quatre bandes ont été observées, indiquant que l'ADN a été coupé en quatre endroits. Cela a produit des bandes calculées à 1 227 pb, 1 443 pb, 2 591 pb et 5 325 pb. Le patient avec la mutation CFTR ΔF508 (+H) et Jeff (JH) dont l'ADN a été coupé avec HindIII devait être coupé une fois pour produire deux bandes de 7 200 pb et 1 800 pb. En réalité, ces deux échantillons ont été coupés une fois, chez le patient +H les tailles des bandes étaient de 6 206 pb et 1 296 pb, alors que chez le patient JH les tailles des bandes étaient de 6 262 pb et 1 296 pb. Ces valeurs sont si similaires que les tailles de bande pourraient être considérées comme identiques.

Discussion

Avec plus de 2000 polymorphismes de mutations de la mucoviscidose, il y a certainement beaucoup de choses qui peuvent mal tourner pour le gène CFTR. Dans l'exemple de la mutation CFTR ∆F508, un seul acide aminé (phénylalanine) est délété en position 508 du gène (Suaud et al. 2011). La suppression de la phénylalanine à cette position est si grave que la protéine CFTR devient dysfonctionnelle, entraînant une hyperproduction de mucus à travers les surfaces épithéliales (Kreda et al. 2012). La protéine CFTR a été identifiée grâce à plusieurs expériences comme un canal anionique activé par la phosphorylation cyclique dépendante de l'adénosine monophosphate (AMPc) qui transporte les sels (ions chlorure et ions bicarbonate) et d'autres anions à travers les cellules épithéliales (Gentzsch, 2018). Des protéines CFTR saines et entièrement fonctionnelles transportent ces sels à travers la membrane plasmique des cellules épithéliales qui tapissent les poumons et d'autres organes pour éliminer l'excès de mucus en hydratant la surface (Gentzch, 2018 Suaud et al. 2011). Dans le cas de la mutation CFTR F508, une protéine CFTR anormale qui ne peut pas se replier correctement est produite, la protéine ne peut pas se replier car la section de CFTR qui interagit avec l'ATP pour lier les nucléotides appelée domaine de liaison aux nucléotides (NBDI) et la quatrième boucle cytosolique dans une autre section de CFTR qui ancre d'autres protéines dans la membrane plasmique (MSD 2) forment des liaisons hydrogène avec l'acide aminé arginine au niveau du codon 1070 (Cutting, 2015). La cellule détecte les protéines CFTR mal repliées et dégrade la plupart d'entre elles dans le réticulum endoplasmique (Suaud et al. 2011). Cela signifie que très peu ou pas de protéine CFTR atteint la surface des cellules épithéliales, par conséquent, les ions chlorure et bicarbonate ne peuvent pas être transportés à travers la membrane plasmique (Suaud et al. 2011). Étant donné que ces ions de sel ne peuvent pas être transportés à travers la membrane plasmique, les sels sont en concentration plus élevée du côté basal des cellules épithéliales, ce qui éloigne l'eau de la surface apicale et conduit à une déshydratation des surfaces pulmonaire, gastro-intestinale et pancréatique (Gentzsch , 2018). Lorsqu'il n'y a pas d'eau sur les surfaces apicales de ces organes, l'excès de mucus ne peut pas être éliminé, puis un mucus dense et collant crée des obstructions et entraîne des maladies respiratoires et une inflammation qui finissent par entraîner la mort des patients (Gentzsch, 2018).

Cette expérience a testé Jeff, 3 ans, pour la mucoviscidose causée par la mutation CFTR F508 en utilisant l'analyse RFLP avec les endonucléases de restriction EcoRI et HindIII. Ses résultats ont été comparés à un contrôle positif (patient avec la mutation ∆F508) et un contrôle négatif (patient sans la mutation ∆F508) qui ont également été inclus dans l'analyse RFLP avec EcoRI et HindIII afin que les résultats de Jeff puissent être comparés à quelque chose. Les résultats de l'analyse RFLP ont été visualisés par électrophorèse sur gel d'agarose (Figure 1) puis une équation a été produite à partir d'une courbe standard (Figure 2) qui a été utilisée pour calculer les tailles moléculaires (Tableau 1) des fragments d'ADN que la restriction endonucléases produites. Ce diagnostic précoce est essentiel pour garantir que Jeff reçoive les soins dont il a besoin afin qu'il puisse vivre une vie longue et sans douleur. De plus, l'analyse RFLP est une méthode beaucoup plus fiable pour tester les troubles autosomiques récessifs que les tests génétiques directs aux consommateurs tels que 23andMeTM, car il y a moins de place pour les malentendus. Des entreprises comme 23andMeTM mesurent la variation génétique en comparant les informations génétiques du client à leur base de données de mutations, cette base de données peut détecter 715 000 mutations d'un seul nucléotide (Lu et al. 2017). Cela signifie que la base de données détecterait la suppression de trois nucléotides qui se produit lorsque la phénylalanine est supprimée à la position 508 du gène CFTR. RFLP est différent de cela car il ne compare pas les séquences génétiques, mais utilise plutôt des endonucléases de restriction pour couper l'ADN en fragments au niveau des séquences de reconnaissance. Dans ce cas, la mucoviscidose pourrait être diagnostiquée si l'ADN d'un patient était coupé aux mêmes endroits qu'un contrôle positif. Un avantage des tests génétiques comme ceux fournis par 23andMeTM est qu'ils peuvent également dire si un patient est porteur d'une mutation récessive, ce que l'analyse RFLP ne peut pas faire (Lu et al. 2017). Cependant, l'une des plus grandes préoccupations concernant les tests génétiques destinés directement aux consommateurs est que la plupart des gens ne savent pas comment interpréter les résultats et peuvent adopter des comportements drastiques en raison de l'absence de conseil génétique (Pare, 2012), c'est une autre raison. pourquoi il est important de tester la mucoviscidose avec RFLP au lieu d'utiliser 23andMeTM.

Il a été émis l'hypothèse que Jeff a la mucoviscidose causée par la mutation CFTR ∆F508 parce qu'il présente plusieurs des symptômes associés à la maladie. Cela serait possible si ses deux parents étaient porteurs de la mutation CFTR F508 car les porteurs ne présentent pas de symptômes puisque la maladie ne survient que lorsque les deux allèles à cet emplacement du gène CFTR sont mutés. Il a été prédit que lorsque l'ADN de Jeff serait coupé par EcoRI deux fois produisant trois bandes avec les tailles 2 150 pb, 2 150 pb et 4 700 pb et que son ADN serait coupé par HindIII une fois produisant deux bandes avec les tailles 7 200 pb et 1 800 pb . De plus, les échantillons EcoRI (patients avec et sans la mutation ∆F508) seraient coupés par EcoRI deux fois de manière identique à l'ADN de Jeff produisant trois bandes avec les tailles 2 150 pb, 2 150 pb et 4 700 pb. Ce qui signifie que l'ADN de Jeff et l'ADN des patients avec et sans la mutation ∆F508 devraient avoir des bandes de taille identique lorsqu'ils sont coupés par EcoRI. De plus, le contrôle positif (patient avec la mutation ∆F508) serait également coupé par HindIII une fois, similaire à l'ADN de Jeff produisant deux bandes avec des tailles de 7 200 pb et 1 800 pb. Ceci contraste avec le contrôle négatif (patient sans la mutation ∆F508) dont l'ADN devait être coupé deux fois, produisant trois bandes avec des tailles de 5 700 pb, 1 800 pb et 1 500 pb. Si l'hypothèse est correcte, alors les bandes qui apparaissent lorsque l'échantillon d'ADN de Jeff est coupé avec HindIII seraient identiques en poids au patient avec la mutation ∆F508 dont l'ADN a également été coupé avec HindIII, et ces deux échantillons devraient être différents que lorsque HindIII a été utilisé avec le patient qui n'a pas la mutation ∆F508.

Le but de l'inclusion du contrôle positif était que les résultats de la digestion par restriction HindIII d'un individu avec la mutation ∆F508 puissent être visualisés et comparés à la façon dont l'ADN de Jeff a été coupé, s'ils ont été coupés de la même manière, cela signifie qu'il a également le même Polymorphisme CFTR. Si son ADN est coupé différemment du contrôle positif, cela signifierait qu'il n'a pas la mutation ∆F508. Le but de l'inclusion du contrôle négatif était que les résultats de la digestion par restriction HindIII d'un individu sans mutation ∆F508 puissent être visualisés puis comparés à la façon dont l'ADN de Jeff a été coupé. Si le contrôle négatif était coupé différemment du contrôle positif et de l'ADN de Jeff, cela signifierait qu'il n'a pas la mutation ∆F508. Cependant, si les résultats de Jeff ne correspondaient ni au positif ni au négatif, cela signifierait que les résultats de l'expérience sont invalides. De plus, si les contrôles positifs et négatifs sont identiques lorsqu'ils sont coupés par HindIII, les résultats expérimentaux seraient invalides. De plus, même si les résultats de l'analyse RFLP seront les mêmes pour Jeff et les contrôles lors de la coupe avec EcoRI, l'EcoRI était toujours inclus car si cela ne produisait pas des résultats identiques pour tous les échantillons, alors les résultats de l'expérience auraient être remis en cause.

Le marqueur qui a été chargé dans la piste 1 s'est déplacé avec succès à travers le gel (Figure 1) et a produit des bandes à 12 000 pb, 7 000 pb, 3 000 pb, 2 500 pb, 2 000 pb, 1 800 pb et 1 500 pb comme prévu (tableau 1). La distance à laquelle chaque bande a migré a été mesurée et ces données ont été tracées par rapport au log de chaque poids moléculaire pour produire une courbe standard qui a donné un coefficient de détermination de 0,8987 et une ligne de meilleur ajustement avec l'équation y=-0,0391x +4,8133 (Figure 2 ). La distance parcourue par chaque bande pour les six échantillons a été insérée dans cette équation, puis l'antilog a été pris pour calculer la taille approximative de la bande. Cette équation a également été utilisée pour calculer la taille des marqueurs afin de déterminer le degré d'erreur mathématique présent dans ce modèle. Le tableau 1 montre que le poids moléculaire calculé est légèrement différent du poids moléculaire réel, cet effet est amplifié lorsque l'ADN a plus de paires de bases. Cela signifie que les résultats des autres échantillons d'ADN pourraient également présenter une certaine variation du poids moléculaire attendu par rapport au poids moléculaire observé des bandes et que même avec une telle variation, les résultats seraient toujours valides. Cette équation a également été utilisée pour calculer les tailles moléculaires des bandes montrées sur le gel de la figure 1. Si l'hypothèse est correcte, l'ADN de Jeff, le patient avec la mutation ∆F508 et le patient sans la mutation ∆F508 seraient tous coupés. deux fois par EcoRI pour produire des bandes avec des poids moléculaires de 2 150 pb, 2 150 pb et 4 700 pb. Étant donné que deux de ces bandes ont le même poids moléculaire, seules deux bandes apparaîtraient sur le gel : 2 150 pb et 4 700 pb. L'observation de ces échantillons d'ADN a montré qu'ils ont tous deux bandes (Figure 1 – pistes 2, 3, 4) et les calculs à partir de l'équation de la courbe standard ont révélé que le poids moléculaire de ces deux bandes dans les trois échantillons était très similaire : dans JE, le les tailles des fragments d'ADN ont été calculées comme 2 568 pb et 5 229 pb dans -E les tailles des bandes ont été calculées comme 2 500 pb et 5 183 pb dans +E les tailles des bandes ont été calculées comme 2 522 pb et 5 325 pb (tableau 1). Étant donné que l'EcoRI a coupé tous les échantillons approximativement au même endroit, on peut en conclure que l'analyse RFLP a fonctionné correctement et que les autres résultats de l'expérience auraient également dû fonctionner correctement. Cela signifie également que le gène CFTR était en fait présent dans tous les échantillons d'ADN, car si l'un des échantillons ne possédait pas le gène CFTR, les échantillons n'auraient pas produit de fragments d'ADN identiques. Cependant, ces résultats seuls ne peuvent pas fournir un diagnostic de mucoviscidose car l'enzyme EcoRI coupe le contrôle positif et négatif de la même manière. Si EcoRI et le contrôle positif avaient été les seuls éléments utilisés pour diagnostiquer Jeff, alors l'hypothèse aurait été acceptée car le gène CFTR est coupé dans les mêmes fragments d'ADN pour le contrôle positif et Jeff. Paradoxalement, si EcoRI et le contrôle négatif avaient été les seuls éléments utilisés pour diagnostiquer Jeff, l'hypothèse aurait été rejetée car le gène CFTR est coupé dans les mêmes fragments d'ADN pour le contrôle négatif et Jeff. Évidemment, cela est problématique car l'hypothèse ne peut pas être à la fois acceptée et rejetée. Par conséquent, pour diagnostiquer avec précision Jeff avec la mucoviscidose, une endonucléase de restriction qui coupe différemment le contrôle positif et négatif doit être utilisée, c'est pourquoi HindIII a également été utilisé.

Si l'hypothèse était correcte, l'ADN de Jeff et le patient (contrôle positif) avec la mutation ∆F508 seraient coupés une fois par HindIII pour produire des bandes avec des poids moléculaires de 7 200 pb et 1 800 pb. L'observation de ces échantillons d'ADN a montré qu'ils avaient tous deux été coupés une fois et avaient deux bandes (Figure 1 - pistes 6 et 7) et les calculs à partir de l'équation de la courbe standard ont révélé que le poids moléculaire de ces deux bandes dans les deux échantillons était similaire : dans JH, le les tailles des bandes ont été calculées à 6 262 pb et 1 296 pb et dans +H, les tailles des bandes ont été calculées à 6 206 pb et 1 296 pb (tableau 1). Étant donné que le HindIII a coupé à la fois l'ADN de Jeff et l'ADN du patient qui a la mutation ∆F508, il est probable que Jeff a également la mutation ∆F508 qui provoque la mucoviscidose. Pour confirmer que ces résultats sont valides, ces deux échantillons doivent être comparés au contrôle négatif - le patient sans la mutation CFTR ∆F508. L'observation a révélé que l'ADN du patient (-H) sans la mutation ∆F508 a été coupé trois fois par HindIII pour produire quatre bandes (Figure 1) et ces bandes ont été calculées pour avoir les poids moléculaires de 1 227 pb, 1 443 pb, 2 591 pb , et 5 325 pb (tableau 1). De toute évidence, ces résultats ne correspondent pas à la prédiction qui indiquait que l'ADN de ce patient serait coupé deux fois par HindIII pour produire trois bandes avec des poids moléculaires de 5 700 pb, 1 800 pb et 1 500 pb. Cependant, les deux bandes supérieures semblent s'aligner avec les bandes des échantillons coupés avec EcoRI. Ce qui signifie que cet échantillon était probablement contaminé par de l'EcoRI. Cela interfère avec l'analyse des résultats, cependant, certaines conclusions peuvent encore être tirées en raison du placement de ces bandes par rapport aux autres échantillons HindIII. Premièrement, les résultats sont suffisamment différents pour que l'on puisse conclure que JH et +H étaient identiques alors que -H était différent. Deuxièmement, l'échantillon -H a une bande qui est en dessous de la bande la plus basse dans +H et JH (Figure 1–pistes 5, 6, 7). Cela aurait du sens si l'hypothèse était correcte car -H devrait avoir sa plus petite bande à 1 500 pb et +H/JH devrait avoir leurs plus petites bandes à 1 800 BP (tableau 1). Troisièmement, la seule façon dont l'échantillon d'ADN de Jeff pourrait être coupé par HindIII à 7 200 pb serait s'il avait la mutation CFTR ∆F508 (figure 1 et tableau 1). Par conséquent, l'hypothèse est acceptée, Jeff est atteint de mucoviscidose causée par la mutation CFTR ∆F508.

Si le contrôle positif avait été omis, le diagnostic serait alors très difficile à faire et l'hypothèse ne pourrait pas être confirmée, car la taille moléculaire calculée des fragments d'ADN de Jeff est différente des tailles moléculaires attendues. L'observation que la taille moléculaire calculée des fragments différait également de la taille attendue pour les fragments d'ADN du contrôle positif et que la taille moléculaire de ces fragments et celle de Jeff étaient presque identiques lorsqu'elles étaient coupées par HindIII était le facteur ultime qui a conduit à accepter l'hypothèse. Si le contrôle négatif avait été omis, alors l'hypothèse aurait toujours été acceptée parce que l'ADN de Jeff aurait toujours correspondu au contrôle positif. Cependant, dans le scénario alternatif où il n'avait pas de mucoviscidose, manquer un contrôle négatif signifierait qu'il serait impossible de confirmer que Jeff n'avait pas de mucoviscidose car ses fragments d'ADN n'auraient rien correspondu une fois coupés par HindIII.

Cette expérience n'a utilisé que le segment du génome de Jeff qui comprenait le gène CFTR. Si nous avions utilisé l'intégralité de son génome d'un patient avec ou sans mutation, alors EcoRI et HindIII auraient localisé beaucoup plus de sites de reconnaissance (GAATTC et AAGCTT respectivement) et clivé des groupes phosphate sur ces sites, cela produirait beaucoup plus de fragments d'ADN. En fait, il y a tellement de fragments d'ADN qu'il serait difficile de dire ce que vous regardez. Au lieu de voir quelques bandes sur la figure 1, il pourrait y avoir des centaines de bandes. Cela rendrait impossible d'identifier si Jeff avait ou non une mutation dans CFTR. Le protocole de laboratoire devrait être modifié si des génomes entiers étaient utilisés afin qu'une région spécifique de l'ADN puisse être examinée.Une façon d'y parvenir est le Southern blot : où les fragments d'ADN de l'électrophorèse sont transférés sur une membrane par transfert capillaire vers le haut, puis immobilisés, permettant d'identifier les bandes correspondant à la séquence CFTR avec une sonde (Brown, 2001).

En conclusion, ces résultats sont significatifs car ils révèlent que HindIII est une endonucléase de restriction très utile pour diagnostiquer la mucoviscidose et le diagnostic de mucoviscidose de Jeff (causée par la mutation CFTR ∆F508) signifie qu'il peut recevoir un traitement personnalisé, le lumacaftor, par exemple, est un médicament qui pourrait bénéficier à Jeff en empêchant la dégradation des protéines CFTR mal repliées causée par la mutation CFTR ∆F508, cela aide les protéines à atteindre la surface des cellules épithéliales apicales afin que la fonction puisse être partiellement restaurée (Kreda et al. 2012). Cette expérience pourrait être améliorée en doublant le nombre d'échantillons pour s'assurer que les échantillons n'ont pas été contaminés par l'endonucléase de restriction incorrecte et en utilisant une ligne de tendance différente qui produit une équation qui calcule les tailles moléculaires avec une précision améliorée. Des études futures peuvent explorer l'application d'autres endonucléases de restriction telles que BamHI, EcoRII, Hand HaeIII pour voir comment elles coupent le CFTR dans les contrôles positifs et négatifs.

Les références

Brown, T (2001) Southern Blot. Curr Protoc Immunol 10(6a).

Cooney, A.L., P.B. McCray Jr et P.L. Sinn (2018) Thérapie génique de la fibrose kystique : regarder en arrière, regarder en avant. Gènes (Bâle) 9(11).

Cutting, G. R. (2015) Génétique de la mucoviscidose : de la compréhension moléculaire à l'application clinique. Rév Nat Genet 16(1) : 45-56.


Questions importantes pour CBSE Classe 12 Biologie Principes de la biotechnologie et outils de la technologie de l'ADN de recombinaison

1. Biotechnologie peut être défini comme l'utilisation de micro-organismes, de plantes ou de cellules animales ou de leurs composants pour produire des produits et des processus utiles à l'homme. Selon la Fédération européenne de biotechnologie (EFB), la biotechnologie est l'intégration des sciences naturelles et des organismes, des cellules, des parties de celles-ci et des analogues moléculaires pour les produits et services. Le terme « biotechnologie » a été inventé par Karl Ereky en 1919.
2. Les principes de la biotechnologie sont basés sur le concept des techniques suivantes :
(i) Génie génétique est la technique pour modifier la chimie du matériel génétique (ADN/ARN), pour les introduire dans d'autres organismes et ainsi changer le phénotype de l'organisme hôte.
(ii) Maintien adéquat de conditions stériles pour favoriser la croissance des seuls microbes/cellules eucaryotes souhaités en grandes quantités pour la fabrication de produits biotechnologiques tels que des antibiotiques, des vaccins, des enzymes, etc.

3. Les techniques de génie génétique comprennent les suivantes :

  • Création de ADN recombiné en combinant les gènes désirés.
  • Transfert de gène.
  • Maintien de l'ADN dans l'hôte et le clonage de gènes.
  • Les étapes de base du génie génétique peuvent être résumées comme suit :
  • Identification de l'ADN avec les gènes désirables.
  • Introduction de l'ADN identifié dans l'hôte.
  • Maintien de l'ADN introduit dans l'hôte et transfert de l'ADN à sa descendance.

4. Construction du premier ADN recombiné artificiel
(i) Il a été obtenu en liant un gène codant pour la résistance aux antibiotiques avec un natif plasmide (un ADN extrachromosomique circulaire à réplication autonome) de Salmonella typhimurium.
(ii) Stanley Cohen et Herbert Boyer accompli cela en 1972.
(iii) Ils ont isolé le gène de résistance aux antibiotiques en coupant un morceau d'ADN d'un plasmide.
(iv) Le découpage de l'ADN à des endroits spécifiques a été effectué par ciseaux moléculaires, c'est à dire. les enzymes de restriction.
(v) Le morceau d'ADN coupé a ensuite été lié à l'ADN plasmidique avec l'ADN enzymatique ligature. L'ADN plasmidique agit comme vecteurs pour transférer le morceau d'ADN qui y est attaché.
(vi) Lorsque cet ADN est transféré dans coli, il peut se répliquer en utilisant l'enzyme ADN polymérase du nouvel hôte et faire plusieurs copies.
(vii) Cette capacité à multiplier des copies du gène de résistance aux antibiotiques dans E. coli s'appelait clonage du gène de résistance aux antibiotiques dans E. coli.

5. Les outils de la technologie de l'ADN recombinant sont les suivants :
(i) Enzymes de restriction (ii) Enzymes polymérases
(iii) Ligases (iv) Vecteurs
(v) Organisme hôte compétent.

6. Les enzymes de restriction ou « ciseaux moléculaires » sont utilisés pour couper l'ADN.
(i) Deux enzymes d'E. coli qui étaient responsables de la restriction de la croissance du bactériophage ont été isolées en 1963, l'une d'entre elles a ajouté un groupe méthyle à l'ADN et l'autre a coupé l'ADN en segments. Cette dernière a été appelée endonucléase de restriction.
(ii) La première endonucléase de restriction Hind II a été isolée par Smith Wilcox et Kelley (1968). Ils ont découvert qu'il coupait toujours les molécules d'ADN à un point particulier en reconnaissant une séquence spécifique de six paires de bases appelée séquence de reconnaissance.
(iii) Outre Hind II, plus de 900 enzymes de restriction ont été isolées à présent, à partir de plus de 230 souches de bactéries, chacune reconnaissant des séquences de reconnaissance différentes.
(iv) Dénomination des enzymes de restriction
(a) La première lettre est dérivée du nom du genre et les deux lettres suivantes du nom de l'espèce de la cellule procaryote à partir de laquelle les enzymes sont extraites.
(b) Les chiffres romains après le nom indiquent l'ordre dans lequel les enzymes ont été isolées de la souche bactérienne.
Par exemple, Eco RI provient d'Escherichia coli RY13 et Eco RII provient d'E. coli R 245, etc.
(v) Les enzymes de restriction appartiennent à une classe d'enzymes appelées Nucléases.
Les nucléases sont de deux types :
Exonucléases Ils enlèvent les nucléotides des extrémités.
Endonucléases Ils coupent à des positions spécifiques dans l'ADN.
(a) Chaque endonucléase de restriction reconnaît un séquence nucléotidique palindromiques dans l'ADN.
(b) palindrome dans l'ADN est a. séquence de paires de bases qui se lit de la même manière sur les deux brins lorsque l'orientation de la lecture reste la même.
Par exemple, les séquences suivantes se lisent de la même manière sur les deux brins dans le sens 5′ –> 3′ ainsi que dans le sens 3′–> 5′.
5′ — GAATTC — 3′
3′ — CTTAAG — 5′
(vi) Mécanisme d'action des enzymes de restriction
(a) Les enzymes de restriction coupent le brin d'ADN un peu à l'écart du centre des sites palindromes, mais entre les deux mêmes bases sur les brins opposés.
(b) Cela laisse des portions simple brin aux extrémités.
(c) Il y a des tronçons en surplomb appelés extrémités collantes sur chaque brin, comme indiqué dans la figure ci-dessus. Ceux-ci sont nommés ainsi, car ils forment des liaisons hydrogène avec leurs homologues coupés complémentaires.
(d) Le caractère collant des extrémités facilite l'action de l'enzyme ADN ligase.
(e) Les endonucléases de restriction sont utilisées en génie génétique pour former des molécules recombinantes d'ADN, qui sont composées d'ADN provenant de différentes sources/génomes.
(f) Ces extrémités collantes sont complémentaires les unes des autres lorsqu'elles sont coupées par la même enzyme de restriction, elles peuvent donc être jointes (bout à bout) à l'aide d'ADN ligases.

7. Séparation et isolement des fragments d'ADN
(i) La coupure de l'ADN par des endonucléases de restriction donne des fragments d'ADN.
(ii) La technique qui sépare les fragments d'ADN en fonction de leur taille est appelée
électrophorèse sur gel.
(iii) Les fragments d'ADN sont des molécules chargées négativement. Ils peuvent être séparés en les forçant à se déplacer vers l'anode sous un champ électrique à travers un milieu/matrice.
(iv) Le milieu le plus couramment utilisé est l'agarose, un polymère naturel extrait d'algues marines.
(v) Les fragments d'ADN se séparent (résolvent) en fonction de leur taille grâce à l'effet de tamisage fourni par le gel d'agarose. Plus la taille du fragment est petite, plus il se déplace loin.
(vi) Les fragments d'ADN séparés ne peuvent être visualisés qu'après coloration de l'ADN avec un composé connu sous le nom de bromure d'éthidium suivi d'une exposition à un rayonnement UV.
(vii) Les fragments d'ADN peuvent être vus comme des bandes de couleur orange vif. Ces bandes séparées sont découpées dans le gel d'agarose et extraites du morceau de gel. C'est appelé élution.
(viii) Les fragments d'ADN purifiés peuvent être utilisés dans la construction d'ADN recombinant en les joignant à des vecteurs de clonage.

8. Clonage de vecteurs sont les molécules d'ADN qui peuvent transporter un segment d'ADN étranger dans la cellule hôte.
(i) Les vecteurs utilisés dans la technologie de l'ADN recombinant peuvent être :
(a) Plasmides ADN extra-chromosomique circulaire à réplication autonome.
(b) Bactériophages Virus infectant les bactéries.
(c) Cosmides Vecteurs hybrides dérivés de plasmides qui contiennent le site cos de X
(ii) Numéro de copie peut être défini comme le nombre de copies de vecteurs présents dans une cellule.
(iii) Bactériophages ont un nombre élevé par cellule, de sorte que leur nombre de copies est également élevé dans le génome.
(iv) Plasmides n'avoir qu'une ou deux copies par cellule.
(v) Le nombre de copies peut varier de 1 à 100 ou plus de 100 copies par cellule.
(vi) Si un morceau d'ADN étranger est lié à un ADN de bactériophage ou de plasmide, son nombre peut être multiplié par le nombre de copies du plasmide ou du bactériophage.
(vii) Fonctionnalités requises pour faciliter le clonage dans le vecteur
(a) Origine de réplication (Ori) (b) Marqueur sélectionnable
(c) Sites de clonage (d) Vecteurs pour le clonage de gènes chez les plantes et les animaux.
(a) Origine de la réplication (Ori) est une séquence à partir de laquelle la réplication commence.

  • Tout morceau d'ADN lié à cette séquence peut être amené à se répliquer dans les cellules hôtes.
  • La séquence est également responsable du contrôle du nombre de copies de l'ADN lié.

(b) Marqueur sélectionnable aide à identifier et à éliminer les non-transformants et à permettre sélectivement la croissance des transformants.

  • Transformation est un processus par lequel un morceau d'ADN est introduit dans une bactérie hôte.
  • Les gènes codant pour la résistance aux antibiotiques tels que l'ampicilline, le chloramphénicol, la tétracycline ou la kanamycine, etc., sont des marqueurs sélectionnables utiles pour le coli.


Vecteur de clonage d'E.coli pBR322 montrant des sites de restriction (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori et des gènes de résistance aux antibiotiques (amp R et tet R ).
rop code pour les protéines impliquées dans la réplication du plasmide.

  • Ligature d'ADN extraterrestre est réalisée sur un site de restriction présent dans l'un des deux gènes de résistance aux antibiotiques. L'exemple est la ligature d'un ADN étranger au site Bam HI du gène de résistance à la tétracycline dans le vecteur pBR322.
    –>>Les plasmides recombinants perdront leur résistance à la tétracycline en raison de l'insertion d'ADN étranger. Mais, il peut toujours être sélectionné parmi les non-recombinants en étalant les transformants sur un milieu contenant de l'ampicilline.
    –>> Les transformants poussant sur un milieu contenant de l'ampicilline sont ensuite transférés sur un milieu contenant de la tétracycline.
    –>>Les recombinants se développeront dans un milieu contenant de l'ampicilline mais pas sur celui contenant de la tétracycline.
    –>>Les non-recombinants se développeront sur le milieu contenant les deux antibiotiques.
    Dans cet exemple, un gène de résistance aux antibiotiques aide à sélectionner les transformants tandis que l'autre gène de résistance aux antibiotiques est «inactivé en raison de l'insertion» d'ADN étranger et aide à la sélection de recombinants.
  • Sélection de recombinants en raison de l'inactivation des antibiotiques est une procédure lourde, donc des marqueurs sélectionnables alternatifs sont développés qui différencient les recombinants des non-recombinants sur la base de leur capacité à produire de la couleur en présence d'un substrat chromogène.

–>> Dans cette méthode, un ADN recombinant est inséré dans la séquence codante d'une enzyme J3-galactosidase.
–>> Il en résulte une inactivation de l'enzyme P-galactosidase (inactivation insertionnelle).
–>> Les colonies bactériennes dont les plasmides n'ont pas d'insert produisent une couleur bleue, mais d'autres ne produisent aucune couleur, lorsqu'elles sont cultivées sur un substrat chromogène.
(c) Sites de clonage sont nécessaires pour lier l'ADN étranger au vecteur.

  • Le vecteur nécessite très peu ou des sites de reconnaissance uniques pour les enzymes de restriction couramment utilisées.
  • La présence de plus d'un site de reconnaissance dans le vecteur générera plusieurs fragments conduisant à des complications dans le clonage de gènes.

(d) Vecteurs pour le clonage de gènes chez les plantes et les animaux sont nombreux qui sont utilisés pour cloner des gènes chez les plantes et les animaux.
Chez les plantes, le plasmide inducteur de tumeur (Ti) d'Agrobacterium tumefaciens est utilisé comme vecteur de clonage.
–>>Agrobacterium tumefaciens est un agent pathogène de plusieurs plantes dicotylédones.
–>> Il délivre un morceau d'ADN connu sous le nom d'ADN-T dans le plasmide Ti qui transforme les cellules végétales normales en cellules tumorales pour produire des produits chimiques requis par les agents pathogènes. Les rétrovirus, adénovirus, papillomavirus sont également maintenant utilisés comme vecteurs de clonage chez les animaux en raison de leur capacité à se transformer. cellules normales en cellules cancéreuses.

9. Organisme hôte compétent (pour la transformation avec de l'ADN recombinant) est nécessaire car l'ADN étant une molécule hydrophile, ne peut pas traverser les membranes cellulaires,
Par conséquent, les bactéries doivent être rendues compétentes pour accepter les molécules d'ADN,
(i) Compétence est la capacité d'une cellule à absorber l'ADN étranger.
(ii) Les méthodes pour rendre une cellule compétente sont les suivantes.
(a) Méthode chimique Dans cette méthode, la cellule est traitée avec une concentration spécifique d'un cation divalent tel que le calcium pour augmenter la taille des pores dans la paroi cellulaire.
Les cellules sont ensuite incubées avec de l'ADN recombinant sur de la glace, puis placées
les brièvement à 42°C puis les remettre sur glace. C'est ce qu'on appelle le traitement de choc thermique. Cela permet aux bactéries d'absorber l'ADN recombinant.
(b) Méthodes physiques Dans cette méthode, un ADN recombinant est directement injecté dans le noyau d'une cellule animale par la méthode de microinjection.
Chez les plantes, les cellules sont bombardées de microparticules d'or à grande vitesse ou
tungstène recouvert d'ADN appelé biolistique ou méthode de canon à gènes.
(c) Des vecteurs pathogènes désarmés lorsqu'il est autorisé à infecter la cellule, transférer l'ADN recombinant dans l'hôte.

Questions d'examen des années précédentes

1 Cochez les questions
1. Pourquoi n'est-il pas possible pour un ADN étranger de faire partie d'un chromosome n'importe où sur sa longueur et de se répliquer normalement ?
[Toute l'Inde 2014]
Rép.L'intégration de l'ADN extraterrestre est nécessaire pour devenir une partie du chromosome. Comme l'ADN lui-même ne peut pas se multiplier et se répliquer, mais nécessite plutôt une séquence spécifique pour initier sa réplication appelée origine de réplication. Par conséquent, l'ADN extraterrestre doit être lié à l'ADN hôte à l'aide d'enzymes et lié à Ori, de manière à faire partie du chromosome et à se répliquer normalement pour produire ses copies.

2. Mentionnez le type de cellules hôtes adaptées aux canons à gènes pour introduire un ADN étranger. [Delhi 2014]
Rép. Les cellules hôtes appropriées pour que les canons à gènes introduisent un ADN étranger sont des cellules végétales.

3. Écrivez les deux composants de la première molécule d'ADN recombiné artificiel construite par Cohen et Boyer. [Étranger 2014]
Rép.Les deux composants de la première molécule d'ADN recombiné artificiel construite par Gohen et Boyer sont :
(i) gène de résistance aux antibiotiques
(ii) plasmide de Salmonella typhimurium

4. Nommez les cellules hôtes dans lesquelles la technique de microinjection est utilisée pour introduire un ADN étranger. [Étranger 2014]
Rép. La technique de microinjection pour introduire de l'ADN étranger est généralement réalisée dans une cellule animale, c'est-à-dire directement dans le noyau.

5. Nommez le matériau utilisé comme matrice en électrophorèse sur gel et mentionnez son rôle. [Toute l'Inde 2014C]
Rép. Le matériau utilisé comme matrice en électrophorèse sur gel est l'agarose.
Ce gel d'agarose agit comme un tamis pour séparer les fragments d'ADN selon leur taille.

6. Écrivez quatre méthodes quelconques utilisées pour introduire un segment d'ADN souhaité dans une cellule bactérienne dans des expériences de technologie de recombinaison. [Toute l'Inde 2013]
Rép. Les moyens d'introduire l'ADN souhaité dans la cellule bactérienne sont les suivants :
(i) microinjection (ii) vecteurs pathogènes désarmés
(iii) partie par cation bivalent tel que le calcium
(iv) bidlistic ou gene gun

7. Expliquez ce qui se passe lorsqu'un gène étranger est ligaturé au site Sal I du plasmide pBR322. [Delhi 2013c]
Rép. Si un gène étranger est lié au site Sal I du gène de résistance à la tétracycline dans le vecteur pBR322, le plasmide recombinant perdra sa résistance à la tétracycline.

8. Mentionner les utilisations du vecteur de clonage en biotechnologie ? [Delhi 2011]
Rép. Utilisations du vecteur de clonage en biotechnologie.
(i) Aide à lier l'ADN étranger/alien avec celui de l'ADN de l'hôte.
(ii) Aide à la sélection des recombinants erf des non-recombinants.

9. Les biotechnologistes se réfèrent à Agrobacterium tumefaciens comme ingénieur génétique naturel des plantes. Donnez des raisons à l'appui de l'affirmation.
[ HOTS Toute l'Inde 2011]
Rép. Agrobacterium tumefacieps est un agent pathogène de plusieurs plantes dicotylédones. Il est utilisé comme ingénieur génétique naturel car il est capable de livrer un morceau de son ADN (appelé ADN-T) pour transformer les cellules végétales normales en cellules tumorales et diriger les cellules tumorales pour synthétiser les produits chimiques requis par l'agent pathogène.

10. Pourquoi est-il essentiel d'avoir un marqueur sélectionnable dans un vecteur de clonage ? [Toute l'Inde 2011]
Rép.Le marqueur sélectionnable dans le vecteur de clonage aide à identifier et à sélectionner les recombinants et à éliminer les non-recombinants.

11. Pourquoi les fragments d'ADN se déplacent-ils vers l'anode lors de l'électrophorèse sur gel ? [hots Delhi 2011c]
Rép. Les fragments d'ADN sont des molécules chargées négativement et, par conséquent, se déplacent vers l'anode pendant l'électrophorèse sur gel.

12. En 1963, deux enzymes responsables de la restriction de la croissance du bactériophage dans E. coli ont été isolées. Comment les enzymes ont-elles agi pour restreindre la croissance du bactériophage ? [Toute l'Inde 2011c]
Rép.Deux enzymes responsables de la restriction de la croissance du bactériophage dans le coli sont : Les exonucléases Ajoutent un groupe méthyle à l'ADN. Les endonucléases coupent l'ADN à des points spécifiques.

13. En quoi l'action de l'exonucléase est-elle différente de celle de l'endonucléase.
[Toute l'Inde 2010]
Rép.L'exonucléase élimine les nucléotides des extrémités de l'ADN, tandis que l'endonucléase coupe l'ADN à des positions spécifiques.

14. Mentionnez le rôle des ciseaux moléculaires dans la technologie de l'ADN recombinant. [Toute l'Inde 2009]
Rép. Des ciseaux moléculaires ou des enzymes de restriction coupent l'ADN à un site spécifique, permettant ainsi d'extraire le gène souhaité et de l'associer à l'ADN de l'hôte.

15. Nommez la technique utilisée pour séparer les fragments d'ADN en laboratoire. [Delhi 2008]
Rép. L'électrophorèse sur gel est utilisée pour séparer les fragments d'ADN en laboratoire.

16. Quel est le rôle du bromure d'éthidium lors de l'électrophorèse sur gel d'agarose de fragments d'ADN ? [Toute l'Inde 2008C]
Rép. Les fragments d'ADN séparés lors de l'électrophorèse sur gel d'agarose sont visualisés après coloration de l'ADN au bromure d'éthidium, en lumière UV. Cette coloration confère à l'ADN une couleur orange vif.
Questions à 2 points
17. Comment fonctionne une nucléase de restriction ? Expliquer. [Toute l'Inde 2014]
Rép. Les nucléases de restriction fonctionnent en inspectant la longueur de la séquence d'ADN, puis en se liant à des séquences de reconnaissance spécifiques et en coupant les brins au niveau des squelettes de phosphate de sucre.
Ces nucléases sont de deux types selon leur mode d'action.
(je) Exonucléases de restriction séquences coupées aux extrémités terminales de l'ADN.
(ii) Endonucléases de restriction coupé entre les deux bases de la séquence de reconnaissance.

18.Ecrire le rôle d'Ori et du site de restriction dans un vecteur de clonage pBR322.
[Delhi 2014]
ou
Comment Ori et les sites de clonage facilitent-ils le clonage dans un vecteur ?
[Toute l'Inde 2008C]
Rép.Ori est une séquence d'ADN à partir de laquelle la réplication commence. Tout morceau d'ADN qui doit se répliquer dans la cellule hôte doit y être lié.
Les sites de clonage font référence au site/à la séquence d'ADN où l'ADN étranger est lié.

19. Expliquez à l'aide d'un exemple approprié la dénomination d'une endonucléase de restriction. [Delhi 2014]
Rép. Les noms des endonucléases de restriction sont :
(i) La première lettre du nom vient du genre et les deux lettres suivantes des espèces de la cellule procaryote d'où les enzymes sont extraites.
(ii) Les chiffres romains suivant le nom indiquent l'ordre dans lequel les enzymes ont été isolées de la souche bactérienne. Par exemple, Eco Rl est dérivé d'Escherichia coli RY 13, Hind II de Haemophilus influenzae Rd, etc.

20. Comment se forment les extrémités collantes d'un brin d'ADN ? Pourquoi sont-ils ainsi appelés ? [Delhi 2014]
Rép.Les extrémités collantes de l'ADN sont formées par l'action d'enzymes endonucléases de restriction. Ces enzymes coupent un peu le brin d'ADN du centre de la séquence palindrome entre les deux mêmes bases sur les deux brins. Il en résulte des étirements simple brin sur les deux brins complémentaires à leurs extrémités.
Ces tronçons en surplomb sont appelés extrémités collantes car ils forment des liaisons hydrogène avec les séquences de paires de bases complémentaires.

21.Comment l'inactivation par insertion d'une enzyme est-elle utilisée comme marqueur sélectionnable pour différencier les recombinants des non-recombinants ?
[Étranger 2014]
Rép. L'activation par insertion de l'enzyme J3-galactosidase, c'est-à-dire en insérant le gène souhaité dans la région codante de l'enzyme, entraîne l'inactivation du gène de la (3-galactosidase chez les recombinants. Le recombinant sur les hôtes transformés est incapable de produire une couleur lorsqu'il est cultivé sur un substrat chromogène , agissant ainsi comme un marqueur sélectionnable pour différencier les recombinants des non-recombinants.

22. Expliquez la séquence de nucléotides palindromique à l'aide d'un exemple approprié. [Étranger 2014]
Rép.La séquence nucléotidique palindromique est la séquence de paires de bases dans l'ADN qui lit la même chose sur les deux brins complémentaires de l'ADN, avec la même orientation de lecture.
Par exemple
5′-GAATTC-3′
3′-CTTAAG-5′

23. Pourquoi les ciseaux moléculaires sont-ils ainsi appelés ? Ecrire leur utilisation en biotechnologie ? [Étranger 2014]
Rép. Les ciseaux moléculaires sont appelés ainsi parce qu'ils coupent l'ADN à des séquences spécifiques entre les paires de bases.
Étant donné que les ciseaux moléculaires des enzymes de restriction coupent l'ADN aux séquences souhaitées et génèrent des extrémités collantes qui facilitent la jonction avec le génome de l'hôte ou l'ADN vecteur, ils jouent un rôle important dans le génie génétique ou la biotechnologie. C'est parce qu'avec l'aide de ces enzymes, nous pouvons couper le gène souhaité et l'introduire dans des vecteurs d'expression.

24. Pourquoi est-il essentiel de rendre les cellules compétentes pour les expériences biotechnologiques ? Énumérez deux manières d'y parvenir.
[Delhi 2014C]
Rép. Étant donné que les molécules d'ADN sont hydrophiles, elles ne peuvent pas traverser les membranes cellulaires. Pour que l'ADN recombinant soit intégré dans le vecteur ou le génome hôte, il est nécessaire que l'ADN soit inséré dans la cellule. Par conséquent, rendre les cellules hôtes compétentes est nécessaire dans les expériences de biotechnologie.
Les deux manières par lesquelles les cellules peuvent être rendues compétentes pour absorber l'ADN sont :
(je) Action chimique En augmentant la concentration de cation divalent, le calcium, augmentant ainsi l'efficacité de l'ADN entrant par les pores de la paroi cellulaire.
(ii) Traitement de choc thermique Incuber les cellules avec de l'ADN recombinant sur de la glace, suivi d'un bref traitement thermique à 42 °C et les remettre à nouveau sur de la glace.

25. En quoi une exonucléase est-elle fonctionnellement différente d'une endonucléase ? Donnez un exemple de deux endonucléases autres que Sal I. [Delhi 2013C]
Rép. Les exonucléases sont les enzymes qui clivent les paires de bases d'ADN à leurs extrémités terminales et agissent sur un simple brin d'ADN ou des lacunes dans l'ADN double brin. Tandis que les endonucléases clive l'ADN en tout point sauf aux extrémités terminales et peuvent couper sur un brin ou sur les deux brins d'ADN double brin, par ex. Eco Rl et Hind II.

26. Expliquez le travail effectué par Cohen et Boyer qui a énormément contribué à la biotechnologie. [Delhi 2012]
Rép. (i) Stanley Cohen et Herbert Boyer ont construit la première molécule d'ADN recombiné artificiel (ADNr).
(ii) Ils ont isolé le gène de résistance aux antibiotiques en coupant un morceau d'ADN d'un plasmide à l'aide d'une enzyme de restriction et l'ont lié à un plasmide natif de Salmonella typhimurium à l'aide de DNAIigase.

27. (i) Un vecteur recombinant avec un gène d'intérêt inséré dans le gène de l'enzyme a-galactosidase est introduit dans une bactérie. Expliquez la méthode qui aiderait à sélectionner des colonies recombinantes à partir de colonies non recombinantes.
(ii) Pourquoi cette méthode (.de sélection appelée inactivation insertionnelle ? [HOTS Toute l'Inde 2012]
Rép. (i) Les colonies recombinantes peuvent être différenciées des colonies non recombinantes par leur incapacité à produire de la couleur en présence d'un substrat chromogène.
Les recombinants ne produisent aucune couleur tandis que les non-recombinants produisent une couleur bleue avec substrat chromogène dans le milieu.
(ii) L'enzyme a-galactosidase devient inactivée lors de l'insertion d'ADN recombinant, dans la séquence codante de l'enzyme. Ainsi, la méthode est appelée inactivation insertionnelle.

28. Expliquer en donnant les raisons pour lesquelles un morceau d'ADN étranger doit être intégré à une séquence spécifique d'ADN hôte pour son clonage ?
[Toute l'Inde 2011]
Rép.La réplication de l'ADN est initiée à partir de la séquence d'ADN spécifique appelée origine de réplication. Pour la multiplication de l'ADN étranger dans l'hôte, il doit être intégré à l'origine de réplication (ori).

29. Énumérez les outils clés utilisés dans la technologie de l'ADN recombinant. [Delhi 2011]
Rép.Les outils clés utilisés dans la technologie de recombinaison sont les enzymes de restriction, les polymérases, les ligases, les vecteurs de clonage et les organismes ou cellules hôtes compétents.

30. Expliquer le rôle des plasmides Ti en biotechnologie. [Delhi 2011]
Rép.Le plasmide Ti d'Agrobacterium est responsable de la transformation naturelle des cellules végétales en tumeurs. Ainsi, il est modifié en un vecteur non pathogène mais est toujours capable de délivrer l'ADN. Ce plasmide désarmé d'Agrobacterium est utilisé comme vecteur pour la transformation des cellules végétales, il s'est ainsi avéré jouer un rôle important en biotechnologie.

31. Comment les vecteurs recombinants sont-ils créés ? Pourquoi un seul type d'endonucléase de restriction est-il nécessaire pour créer un vecteur recombinant ? [Étranger 2011]
Rép.Création de vecteurs recombinants L'ADN vecteur est coupé à un site de restriction particulier par une enzyme de restriction, la même qui a été utilisée pour couper le segment d'ADN souhaité. L'ADN étranger est ensuite lié à l'ADN vecteur en utilisant l'enzyme ligase pour former le vecteur recombinant.
Depuis, une enzyme de restriction reconnaît et coupe l'ADN à une séquence particulière
appelé site de reconnaissance, la même enzyme de restriction est utilisée pour couper le segment d'ADN à la fois du vecteur et de l'autre source, sp pour produire les mêmes extrémités collantes dans les deux molécules d'ADN pour faciliter leur jonction.

32. Étudiez le schéma ci-dessous et répondez aux questions suivantes
(i) Pourquoi les fragments d'ADN de la banque D se sont-ils éloignés davantage par rapport à ceux de la bande C ?
(ii) Identifiez l'extrémité de l'anode dans le schéma.
(iii) Comment ces fragments d'ADN sont-ils visualisés ? [Étranger 2011]
Rép. (i) Dans la bande D, les fragments d'ADN sont plus petits que ceux de la bande C. Les fragments se séparent selon leur taille grâce à l'effet de tamisage fourni par le gel Ainsi, les fragments plus petits s'éloignent plus que les plus gros.
(ii) B est l'extrémité de l'anode dans le diagramme.
(iii) Le gel contenant des fragments d'ADN est coloré au bromure d'éthidium et exposé à un rayonnement UV. Des bandes d'ADN de couleur orange deviennent visibles.

33. Un ADN recombiné se forme lorsque les extrémités cohésives de l'ADN vecteur et de l'ADN étranger se rejoignent. Expliquez comment les extrémités collantes se forment et se rejoignent ? [Toute l'Inde 2010]
Rép.Des extrémités collantes se forment lorsqu'une enzyme de restriction coupe les brins d'ADN un peu à l'écart du centre de la séquence palindromique.
Les extrémités cohésives sont reliées par le facteur complémentaire de deux bases de brins polynucléotidiques et par l'action d'une enzyme, l'ADN ligase.

34. Expliquer l'action de l'endonucléase de restriction Eco RI.
[Étranger 2010]
Rép.L'endonucléase de restriction Eco Rl coupe les brins d'ADN un peu à l'écart du centre de la séquence palindromique, mais entre les deux mêmes bases sur les deux brins, c'est-à-dire G et A.
5′-GAATTC-3′
3′- C T T A A G- 5′
(i) Pour cette raison, des portions monocaténaires appelées extrémités collantes, surplombent à l'extrémité de chaque brin.
(ii) En raison du caractère collant, ils forment facilement des liaisons hydrogène avec leurs homologues complémentaires.

35. Comment les fragments d'ADN séparés par électrophorèse sur gel sont-ils visualisés et séparés pour être utilisés dans la construction d'ADN recombinant ?
[ Étranger 201 Toute l'Inde 2008]
Rép. Les fragments d'ADN séparés sont colorés au bromure d'éthidium.
(i) Par l'exposition au rayonnement UV, les fragments d'ADN séparés deviennent visibles sous forme de bandes de couleur orange.
(ii) Les bandes d'ADN séparées sont découpées du gel d'agarose et l'ADN est extrait de ces morceaux de gel, ce processus est appelé élution.

36. (i) Illustrer la séquence de reconnaissance d'Eco RI et mentionner comment ces séquences sont appelées ?
(ii) Comment l'endonucléase de restriction agit-elle sur une molécule d'ADN ?
[Toute l'Inde 2010 C]
Rép.(/’) Séquence de reconnaissance d'Eco Rl
5′- G A A T T C -3′
3′- C T T A A G -3′
Ces séquences sont appelées séquences nucléotidiques palindromiques.
(ii) L'endonucléase de restriction agit sur une longueur spécifiée d'un ADN et se lie à l'ADN au niveau de la séquence de reconnaissance spécifique. Il coupe à la fois les doubles brins de l'ADN, au niveau des squelettes sucre phosphate, un peu à l'écart du centre des sites palindromiques entre la séquence ou les points spécifiques.

37. Nommez l'organisme source à partir duquel le plasmide Ti est isolé. Expliquer l'utilisation de ce plasmide en biotechnologie. [Étranger 2009]
Rép. Le plasmide Ti est isolé à partir de bactéries Agrobacterium tumefaciens.
Le plasmide Ti d'Agrobacterium est responsable de la transformation naturelle des cellules végétales en tumeurs. Ainsi, il est modifié en un vecteur non pathogène mais est toujours capable de délivrer l'ADN. Ce plasmide désarmé d'Agrobacterium est utilisé comme vecteur pour la transformation des cellules végétales, il s'est ainsi avéré jouer un rôle important en biotechnologie.

38. Nommez la source naturelle d'agarose. Mentionnez un rôle de l'agarose en biotechnologie. [Delhi 2009c]
Rép.La source naturelle d'agarose est l'algue marine. Rôle de l'agarose en biotechnologie
(i) Il est utilisé pour développer la matrice pour l'électrophorèse sur gel.
(ii) Il aide à la séparation des fragments sur la base de leur taille.

39. Étudiez la liaison des fragments d'ADN ci-dessous :

Vecteur de clonage d'E.coli pBR322 montrant des sites de restriction (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori et des gènes de résistance aux antibiotiques (amp R et tet R ).
rop code pour les protéines impliquées dans la réplication du plasmide.

  • Nommez l'ADN A et l'ADN B.
  • Nommez l'enzyme de restriction qui reconnaît ce palindrome.

Nommez l'enzyme qui peut lier ces deux fragments d'ADN.
[Delhi 2008]
Rép. (i) Un vecteur –/ADN plasmidique
B – ADN étranger
(ii) Eco Rl
(iii) ADN ligase40. Ce qui suit illustre la liaison de fragments d'ADN.

(i) Nom A et B.
(ii) Complétez le palindrome, qui est reconnu par Eco RI.
(iii) Nommez l'enzyme qui peut lier les deux fragments d'ADN.
[Étranger 2008]
Rép.(i) ADN vectoriel A –, ADN B-étranger
(ii) 5′- CAATT-3′
3′- CTTAAG-5′
(iii) ADN ligase
Questions à 3 points

41. Nommez et décrivez la technique qui aide à séparer les fragments d'ADN formés par l'utilisation d'endonucléases de restriction. [Toute l'Inde 2014]
Rép. Les fragments d'ADN formés par l'utilisation d'endonucléases de restriction sont séparés par électrophorèse sur gel.
(i) Les fragments d'ADN sont des molécules chargées négativement. Ainsi, ils se déplacent vers l'anode sous champ électrique à travers le milieu.
(ii) Les fragments d'ADN se séparent en fonction de leur taille en raison de l'effet de tamisage du gel d'agarose.
(iii) Les fragments d'ADN séparés peuvent être visualisés en colorant l'ADN avec du bromure d'éthidium suivi d'une exposition à un rayonnement UV.
(iv) Les bandes d'ADN séparées sont coupées et extraites du morceau de gel. C'est ce qu'on appelle l'élution.

42. Dessinez un diagramme schématique du vecteur de coliclonage pBR322 et marquez ce qui suit.

  • ou Je
  • décrocher
  • gène de résistance à l'ampicilline
  • gène de résistance à la tétracycline
  • site de restriction Bam HI
  • site de restriction EcoRI

(i) Dessiner des diagrammes schématiques de segments d'un vecteur et d'un ADN étranger avec la séquence de nucléotides reconnue par Eco
(ii) Dessiner le segment d'ADN vecteur et les segments d'ADN étranger après l'action d'EcoRI et marquer les extrémités cohésives produites. [Delhi 2014C]
ou
Dessinez un croquis schématique du plasmide pBR322 et étiquetez ce qui suit

  • Deux sites de restriction quelconques.
  • Ori et rop
  • Un gène de résistance aux antibiotiques. [Delhi 2012].

Rép. coli vecteur de clonage pBR322.
Vecteur de clonage d'E.coli pBR322 montrant des sites de restriction (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori et des gènes de résistance aux antibiotiques (amp R et tet R ).
rop code pour les protéines impliquées dans la réplication du plasmide.
ou
(a) Les enzymes de restriction coupent le brin d'ADN un peu à l'écart du centre des sites palindromes, mais entre les deux mêmes bases sur les brins opposés.
(b) Cela laisse des portions simple brin aux extrémités.
(c) Il y a des tronçons en surplomb appelés extrémités collantes sur chaque brin, comme indiqué dans la figure ci-dessus. Ceux-ci sont nommés ainsi, car ils forment des liaisons hydrogène avec leurs homologues coupés complémentaires.
(d) Le caractère collant des extrémités facilite l'action de l'enzyme ADN ligase.
(e) Les endonucléases de restriction sont utilisées en génie génétique pour former des molécules recombinantes d'ADN, qui sont composées d'ADN provenant de différentes sources/génomes.
(f) Ces extrémités collantes sont complémentaires les unes des autres lorsqu'elles sont coupées par la même enzyme de restriction, elles peuvent donc être jointes (bout à bout) à l'aide d'ADN ligases.43. Que sont les ‘sites de clonage’ dans un vecteur de clonage ? Expliquez leur rôle. Nommez deux de ces sites dans pBR322. [Toute l'Inde 2014C]
Rép.Les sites de clonage sont en fait la séquence de reconnaissance unique spécifique pour une enzyme de restriction particulière, de manière à lier l'ADN étranger à l'ADN vecteur pour créer des molécules d'ADN recombinantes, (l) Ces sites sont importants pour la jonction de fragments d'ADN de vecteur et d'alien ADN. De plus, de multiples séquences de reconnaissance pour une enzyme de restriction particulière dans un ADN ou un vecteur compliqueront le processus de clonage de gènes.
Les deux sites de clonage dans pBR322 sont Bam HI du gène résistant à la tétracycline et Pvu I des gènes résistants aux ampiciMies.

44. Comment les fragments d'ADN sont-ils séparés et isolés pour les empreintes génétiques ? Expliquer. [Étranger 2012]
Rép. Les fragments d'ADN formés par l'utilisation d'endonucléases de restriction sont séparés par électrophorèse sur gel.
(i) Les fragments d'ADN sont des molécules chargées négativement. Ainsi, ils se déplacent vers l'anode sous champ électrique à travers le milieu.
(ii) Les fragments d'ADN se séparent en fonction de leur taille en raison de l'effet de tamisage du gel d'agarose.
(iii) Les fragments d'ADN séparés peuvent être visualisés en colorant l'ADN avec du bromure d'éthidium suivi d'une exposition à un rayonnement UV.
(iv) Les bandes d'ADN séparées sont coupées et extraites du morceau de gel. C'est ce qu'on appelle l'élution

45. (i) Pourquoi les endonucléases de restriction sont-elles appelées ainsi ?
(ii) Qu'est-ce qu'une séquence nucléotidique palindromique ? Comment les endonucléases de restriction agissent-elles sur les sites palindromiques, pour créer des extrémités collantes ?
[Delhi 2011C]
Rép. (i) Les endonucléases de restriction sont appelées ainsi parce qu'elles reconnaissent et coupent à des positions spécifiques dans l'ADN et restreignent la croissance du bactériophage.
(ii) (a) Le palindrome dans l'ADN est une séquence de paires de bases qui se lit de la même manière sur les deux brins d'ADN lorsque l'orientation de la lecture reste la même.
Par exemple,
5’—GAATTG—3′
3’—CTTAAG—5′
(b) Les enzymes de restriction coupent le brin d'ADN un peu à l'écart du centre du site palindrome, mais entre les deux mêmes bases dans les deux brins. Cela crée des tronçons simples, en surplomb aux extrémités du palindrome, appelés extrémités collantes.

46. ​​Comment les éléments suivants sont-ils utilisés en biotechnologie ?

  • ADN plasmidique
  • Séquence de reconnaissance
  • Électrophorèse sur gel [All India 2011c]

Rép. (i) ADN plasmidique Il est utilisé pour construire de l'ADN recombinant, en ligaturant le morceau d'ADN étranger avec lui. Il est utilisé comme vecteur de clonage et aide à la sélection de recombinants à partir de non-recombinants.

(ii) Séquences de reconnaissance Ce sont des séquences de bases spécifiques d'ADN, où l'enzyme de restriction coupe l'ADN. Ils sont utilisés pour extraire le gène ou les fragments souhaités à partir de molécules d'ADN.
(iii) Électrophorèse sur gel C'est une technique, utilisée pour séparer les fragments d'ADN en fonction de leur taille grâce à l'effet de tamisage du gel.47. EcoRI est utilisé pour couper un segment d'ADN étranger et celui d'un ADN vecteur pour former un ADN recombinant. Montrer à l'aide de diagrammes schématiques.

  • L'ensemble de séquences de nucléotides palindromiques de paires de bases que l'EcoRI reconnaîtra dans les deux segments d'ADN. Marquez le site sur lequel EcoRI agira et coupez les deux segments.
  • Des extrémités collantes se sont formées sur les deux segments, où les deux segments d'ADN se joindront plus tard pour former un ADN recombinant. [Delhi 2010]

Rép. La séquence palindromique de Eco Rl est

5′ G AATTC 3′
3’C TTAA G 5′ t
(les flèches indiquent le site, où il coupe les brins.)
(ii) Des extrémités collantes formées sur les deux segments.
(a) Les enzymes de restriction coupent le brin d'ADN un peu à l'écart du centre des sites palindromes, mais entre les deux mêmes bases sur les brins opposés.
(b) Cela laisse des portions simple brin aux extrémités.
(c) Il y a des tronçons en surplomb appelés extrémités collantes sur chaque brin, comme indiqué dans la figure ci-dessus. Ceux-ci sont nommés ainsi, car ils forment des liaisons hydrogène avec leurs homologues coupés complémentaires.
(d) Le caractère collant des extrémités facilite l'action de l'enzyme ADN ligase.
(e) Les endonucléases de restriction sont utilisées en génie génétique pour former des molécules recombinantes d'ADN, qui sont composées d'ADN provenant de différentes sources/génomes.
(f) Ces extrémités collantes sont complémentaires les unes des autres lorsqu'elles sont coupées par la même enzyme de restriction, elles peuvent donc être jointes (bout à bout) à l'aide d'ADN ligases.48. (i) Nommez l'organisme dans lequel le vecteur montré est inséré pour obtenir les copies du gène souhaité.

  • Mentionnez la zone marquée dans le vecteur responsable du contrôle du nombre de copies du gène inséré.
  • Nommer et expliquer le rôle d'unmarqueur sélectionnable dans le vecteur illustré. [Toute l'Inde 2010]

Rép. (i) Escherichia coli (E. coli)
(ii) Ori dans le vecteur est responsable du contrôle du nombre de copies du gène inséré.
(iii) Les gènes codant pour la résistance aux antibiotiques comme tet R résistant à la tétracycline, amp R résistant à l'ampicilline sont utilisés comme marqueurs sélectionnables. Si un ADN étranger est lié au site Bam HI du gène de résistance à la tétracycline, les plasmides recombinants perdront la résistance à la tétracycline.
Les marqueurs sélectionnables aident à identifier et à éliminer les non-transformants et à permettre sélectivement la croissance des transformants.

49. (i) EcoRI est une endonucléase de restriction. Comment s'appelle-t-il ainsi ? Expliquer.
(ii) Écrivez la séquence de bases d'ADN que l'enzyme reconnaît. Mentionnez le point auquel l'enzyme fait une coupure dans le segment d'ADN. [Delhi 2010c]
Rép.(I) Les noms des endonucléases de restriction sont :
(i) La première lettre du nom vient du genre et les deux lettres suivantes des espèces de la cellule procaryote d'où les enzymes sont extraites.
(ii) Les chiffres romains suivant le nom indiquent l'ordre dans lequel les enzymes ont été isolées de la souche bactérienne. Par exemple, Eco Rl est dérivé d'Escherichia coli RY 13, Hind II de Haemophilus influenzae Rd, etc.
(II) La séquence de reconnaissance est un palindrome, où la séquence de la paire de bases se lit de la même manière sur les deux brins d'ADN, lorsque l'orientation de la lecture reste la même,
par exemple, 5′- GAATTC -3′
3′- CTTAAG -5′
L'enzyme Eco Rl elle coupe le segment d'ADN aux bases G et A sur les deux brins uniquement lorsque la séquence GAATTC

50. (i) Nommez la technique utilisée pour la séparation des fragments d'ADN.

  • Écrivez le type de matrice utilisé dans cette technique.
  • Comment l'ADN séparé est-il visualisé et extrait pour une utilisation dans la technologie de recombinaison ? [Toute l'Inde 2010]

Rép. (i) Électrophorèse sur gel.

(ii) Le matériau utilisé comme matrice dans l'électrophorèse sur gel est l'agarose.
Ce gel d'agarose agit comme un tamis pour séparer les fragments d'ADN selon leur taille.
(iii) Les fragments d'ADN séparés sont colorés avec du bromure d'éthidium.
(a) Par l'exposition au rayonnement UV, les fragments d'ADN séparés deviennent visibles sous forme de bandes de couleur orange.
(b) Les bandes d'ADN séparées sont découpées dans le gel d'agarose et l'ADN est extrait de ces morceaux de gel, ce processus est appelé élution.

51. (i) Identifiez les marchés sélectionnables dans le diagramme du vecteur E. coli ci-dessous.
Rép. (i) A – Résistance à l'ampicillineD – Résistance à la tétracycline sont utilisés comme marqueurs sélectionnables dans le vecteur de clonage E. coli.
(ii) La séquence codante de l'a-galactosidase est un meilleur marqueur, car les recombinants et les non-recombinés sont différenciés sur la base de leur capacité à produire de la couleur en présence d'un substrat chromogène, tandis que la sélection de recombinants due à l'inactivation de l'antibiotique gène résistant est un processus fastidieux et long pour les cultiver simultanément sur deux antibiotiques séparément.
(a) L'introduction d'ADNr dans la séquence codante de l'a-galactosidase conduit à une inactivation insertionnelle.
(ii) Les recombinants ne produisent pas de couleur bleue, tandis que les non-recombinants produisent une couleur bleue.

52. Nommer et expliquer les techniques utilisées pour la séparation et l'isolement des fragments d'ADN à utiliser dans la technologie de l'ADN recombinant.
[Toute l'Inde 2009]
Rép.Les fragments d'ADN formés par l'utilisation d'endonucléases de restriction sont séparés par électrophorèse sur gel.
(i) Les fragments d'ADN sont des molécules chargées négativement. Ainsi, ils se déplacent vers l'anode sous champ électrique à travers le milieu.
(ii) Les fragments d'ADN se séparent en fonction de leur taille en raison de l'effet de tamisage du gel d'agarose.
(iii) Les fragments d'ADN séparés peuvent être visualisés en colorant l'ADN avec du bromure d'éthidium suivi d'une exposition à un rayonnement UV.
(iv) Les bandes d'ADN séparées sont coupées et extraites du morceau de gel. C'est ce qu'on appelle l'élution.

53. Pourquoi les gènes codant pour la résistance aux antibiotiques sont-ils considérés comme des marqueurs sélectionnables utiles pour le vecteur de clonage de coli ? Expliquez à l'aide d'un exemple. [Delhi 2009c]
Rép. Les gènes codant pour la résistance aux antibiotiques sont considérés comme utiles sélectionnables
marqueurs parce que le £ normal. coli ne présentent pas de résistance contre aucun de ces antibiotiques.
Exemple Un ADN étranger est ligaturé au site Bam HI du gène de résistance à la tétracycline dans le vecteur pBR322. Les plasmides recombinants perdront leur résistance à la tétracycline en raison de l'insertion d'ADN étranger mais peuvent toujours être sélectionnés parmi les non-recombinants en étalant les transformants sur un milieu contenant de l'ampicilline.
Les transformants poussant sur un milieu contenant de l'ampicilline sont ensuite transférés sur un milieu contenant de la tétracycline. Les recombinants ne se développeront pas, tandis que les non-recombinants se développeront sur le milieu contenant les deux antibiotiques. Gène de résistance aux antibiotiques, aide ainsi à sélectionner les transformants.

54. (i) Écrivez la séquence de nucléotides palindromique pour le segment d'ADN suivant
5′- GAATTC- 3′

  • Nommez l'endonucléase de restriction qui reconnaît cette séquence.
  • Comment les extrémités collantes sont-elles produites ? Mentionnez leur rôle. [Toute l'Inde 2009]

Rép. (i) Séquence palindromique pour

5′- GAATTC- 3′
3′- CTTAAG -5′.
(ii) L'endonucléase de restriction Eco RI reconnaît la séquence palindromique ci-dessus.
(iii) Les extrémités collantes de l'ADN sont formées par l'action d'enzymes endonucléases de restriction. Ces enzymes coupent un peu le brin d'ADN du centre de la séquence palindrome entre les deux mêmes bases sur les deux brins. Il en résulte des étirements simple brin sur les deux brins complémentaires à leurs extrémités.
Ces tronçons en surplomb sont appelés extrémités collantes car ils forment des liaisons hydrogène avec les séquences de paires de bases complémentaires.
Rôle des extrémités collantes Ces extrémités collantes produites forment des liaisons hydrogène avec leurs homologues coupés complémentaires. Ce caractère collant des extrémités facilite l'action de l'enzyme ADN ligase.

55. (i) Que sont les ciseaux moléculaires ?
Donnez un exemple.
(ii) Expliquez leur rôle dans la technologie de l'ADN recombinant.
[Delhi 2008 Étranger 2008]
ou
(i) Nommez la catégorie d'enzymes qui coupent à un site spécifique dans la molécule d'ADN. Donne un exemple.
(ii) Expliquez, comment fonctionnent ces enzymes ? Mentionnez leur utilisation en génie génétique. [Toute l'Inde 2008C]
Rép. (je) Les ciseaux moléculaires sont les endonucléases de restriction car ils coupent les segments d'ADN à des emplacements particuliers ou à une séquence spécifique, par ex. Eco Rl.
(ii) Les enzymes de restriction coupent le brin d'ADN un peu à l'écart du centre des sites palindromiques, mais entre les deux mêmes bases sur les brins opposés. Cela laisse des portions à brin unique aux extrémités avec des tronçons en surplomb appelés extrémités collantes sur chaque brin. Ces extrémités forment des liaisons hydrogène avec leurs homologues coupés complémentaires. Ce caractère collant des extrémités facilite l'action de l'enzyme ADN ligase.

56. Pourquoi Agrobacterium tumefaciens est-il un bon vecteur de clonage ? Expliquer.
[Toute l'Inde 2008]
Rép. Agrobacterium tumefaciens est une bactérie du sol qui provoque des maladies chez de nombreuses plantes dicotylédones. C'est un vecteur naturel car il est capable de délivrer un morceau d'ADN connu sous le nom d'ADN-T pour transformer les cellules normales en cellules tumorales et diriger ces cellules tumorales pour produire les produits chimiques requis par l'agent pathogène.
Le plasmide inducteur de tumeur (Ti) d'A. tumefaciens a maintenant été modifié en un vecteur de clonage, qui n'est plus pathogène pour les plantes mais délivre toujours le gène d'intérêt, qui est incorporé dans le génome de la plante.

57. Expliquez l'importance de
(i) ori (ii) amp R et (iii) rop dans le vecteur E. coli indiqué ci-dessous.
[Toute l'Inde 2008]
Rép.(i) Ori est la séquence d'ADN à partir de laquelle la réplication commence et tout morceau d'ADN, lorsqu'il est lié à cette séquence, peut être amené à se répliquer dans les cellules hôtes.
Il est également responsable du contrôle du nombre de copies de l'ADN lié.
(ii) amp R est un gène de résistance aux antibiotiques dans lequel la ligature de l'ADN étranger est effectuée à un site de restriction.
(iii) rop code pour les protéines impliquées dans la réplication du plasmide.

58. Un vecteur est conçu avec trois caractéristiques qui facilitent son clonage dans la cellule hôte. Énumérez les trois caractéristiques et expliquez chacune d'elles.
[Étranger 2008]
Rép. Les caractéristiques qui facilitent le clonage du vecteur sont :
(je) Origine de la réplication (Ou Je)

  • C'est la séquence d'ADN à partir de laquelle la réplication commence.
  • Tout morceau d'ADN étranger/étranger qui lui est lié est fait pour se répliquer dans la cellule hôte. Il décide également du nombre de copies de l'ADN lié.
    (ii) Marqueur sélectionnable est un gène marqueur, qui aide à sélectionner les cellules hôtes, qui sont des transformants/recombinants des non-recombinants.
    Par exemple, les gènes résistants à l'ampicilline et à la tétracycline dans £. coli.
    (iii) Le site de clonage est un site de reconnaissance unique dans un vecteur pour lier l'ADN étranger. La présence d'un site de clonage/reconnaissance particulier aide l'enzyme de restriction particulière à couper l'ADN vecteur. Un site de reconnaissance unique est généralement préféré.
    (iv) Petite taille du vecteur La petite taille facilite l'introduction de l'ADN dans l'hôte facilement.

59. Pourquoi une cellule doit être rendue compétente pour capter l'ADN ? Expliquez les étapes par lesquelles une cellule bactérienne est rendue compétente pour capter le plasmide/l'ADNr. [Delhi 2008C]

Rép. L'ADN étant une molécule hydrophile ne peut pas traverser la membrane cellulaire. Par conséquent, la cellule bactérienne est rendue compétente pour accepter la molécule d'ADN. Ainsi, la compétence est la capacité d'une cellule à absorber l'ADN étranger.
Les méthodes suivantes sont utilisées pour rendre une cellule bactérienne compétente :
les bactéries doivent être rendues compétentes pour accepter les molécules d'ADN,
(i) Compétence est la capacité d'une cellule à absorber l'ADN étranger.
(ii) Les méthodes pour rendre une cellule compétente sont les suivantes.
(a) Méthode chimique Dans cette méthode, la cellule est traitée avec une concentration spécifique d'un cation divalent tel que le calcium pour augmenter la taille des pores dans la paroi cellulaire.

  • Les cellules sont ensuite incubées avec de l'ADN recombinant sur de la glace, puis placées
  • les brièvement à 42°C puis les remettre sur glace. C'est ce qu'on appelle le traitement de choc thermique.
    • Cela permet aux bactéries de capter l'ADN recombinant.
    (b) Méthodes physiques Dans cette méthode, un ADN recombinant est directement injecté dans le noyau d'une cellule animale par la méthode de microinjection.
    • Dans les plantes, les cellules sont bombardées de microparticules d'or à grande vitesse ou
    tungstène recouvert d'ADN appelé biolistique ou méthode de canon à gènes.
    (c) Des vecteurs pathogènes désarmés lorsqu'il est autorisé à infecter la cellule, transférer l'ADN recombinant dans l'hôte.

60. Lisez la séquence de bases suivante d'un certain brin d'ADN et répondez aux questions suivantes :

  • Qu'appelle-t-on séquence palindromique dans un ADN ?
  • Écrivez la séquence nucléotidique palindromique indiquée dans le brin d'ADN donné et mentionnez l'enzyme qui reconnaîtra une telle séquence.
  • Énoncer l'importance des enzymes qui identifient les séquences de nucléotides palindromiques. [Toute l'Inde 2008C]

Rép. (i) Les séquences palindromiques dans un ADN sont des séquences de bases qui se lisent, à la fois dans le sens avant et dans le sens arrière.
(ii) Séquence palindromique dans l'ADN 5′- GAATTC-3′
3 – CTTAAG-5′
La séquence se lit de la même manière sur les deux brins dans la direction 5′-> 3′. C'est également la même chose si lu dans le sens 3′->5′. L'endonucléase de restriction reconnaît une telle séquence.
L'ADN étant une molécule hydrophile ne peut pas traverser la membrane cellulaire. Par conséquent, la cellule bactérienne est rendue compétente pour accepter la molécule d'ADN. Ainsi, la compétence est la capacité d'une cellule à absorber l'ADN étranger.
Les méthodes suivantes sont utilisées pour rendre une cellule bactérienne compétente :
les bactéries doivent être rendues compétentes pour accepter les molécules d'ADN,
(i) Compétence est la capacité d'une cellule à absorber l'ADN étranger.
(ii) Les méthodes pour rendre une cellule compétente sont les suivantes.
(a) Méthode chimique Dans cette méthode, la cellule est traitée avec une concentration spécifique d'un cation divalent tel que le calcium pour augmenter la taille des pores dans la paroi cellulaire.

les brièvement à 42°C puis les remettre sur glace. C'est ce qu'on appelle le traitement de choc thermique.
• Cela permet aux bactéries de capter l'ADN recombinant.
(b) Méthodes physiques Dans cette méthode, un ADN recombinant est directement injecté dans le noyau d'une cellule animale par la méthode de microinjection.
• Dans les plantes, les cellules sont bombardées de microparticules d'or à grande vitesse ou
tungstène recouvert d'ADN appelé biolistique ou méthode de canon à gènes.
(c) Des vecteurs pathogènes désarmés lorsqu'il est autorisé à infecter la cellule, transférer l'ADN recombinant dans l'hôte.
Importance des endonucléases de restriction Elles sont utilisées en génie génétique pour former des molécules recombinantes d'ADN,
qui sont composés d'ADN provenant de différentes sources/génomes et permettent d'isoler le fragment de gène souhaité et de le joindre à l'hôte sur l'ADN vecteur en raison des extrémités cohésives générées.
5 points de questions

61. (i) Décrivez les caractéristiques qu'un vecteur de clonage doit posséder.
(ii) Pourquoi l'ADN ne peut pas traverser la membrane cellulaire ? Expliquer. Comment une cellule bactérienne est-elle rendue compétente pour absorber l'ADN recombinant du milieu ? [Toute l'Inde 2011]
Rép.(I) Les fonctionnalités suivantes sont nécessaires pour faciliter le clonage dans un vecteur
Les caractéristiques qui facilitent le clonage du vecteur sont :
(je) Origine de la réplication (Ou Je)

  • C'est la séquence d'ADN à partir de laquelle la réplication commence.
  • Tout morceau d'ADN étranger/étranger qui lui est lié est fait pour se répliquer dans la cellule hôte. Il décide également du nombre de copies de l'ADN lié.

(ii) Marqueur sélectionnable est un gène marqueur, qui aide à sélectionner les cellules hôtes, qui sont des transformants/recombinants des non-recombinants.
Par exemple, les gènes résistants à l'ampicilline et à la tétracycline dans £. coli.
(iii) Le site de clonage est un site de reconnaissance unique dans un vecteur pour lier l'ADN étranger. La présence d'un site de clonage/reconnaissance particulier aide l'enzyme de restriction particulière à couper l'ADN vecteur. Un site de reconnaissance unique est généralement préféré.
(iv) Petite taille du vecteur La petite taille facilite l'introduction de l'ADN dans l'hôte facilement.
(II) L'ADN étant une molécule hydrophile ne peut pas traverser la membrane cellulaire. Par conséquent, la cellule bactérienne est rendue compétente pour accepter la molécule d'ADN. Ainsi, la compétence est la capacité d'une cellule à absorber l'ADN étranger.
Les méthodes suivantes sont utilisées pour rendre une cellule bactérienne compétente :
les bactéries doivent être rendues compétentes pour accepter les molécules d'ADN,
(i) Compétence est la capacité d'une cellule à absorber l'ADN étranger.
(ii) Les méthodes pour rendre une cellule compétente sont les suivantes.
(a) Méthode chimique Dans cette méthode, la cellule est traitée avec une concentration spécifique d'un cation divalent tel que le calcium pour augmenter la taille des pores dans la paroi cellulaire.

les brièvement à 42°C puis les remettre sur glace. C'est ce qu'on appelle le traitement de choc thermique.
• Cela permet aux bactéries de capter l'ADN recombinant.
(b) Méthodes physiques Dans cette méthode, un ADN recombinant est directement injecté dans le noyau d'une cellule animale par la méthode de microinjection.
• Dans les plantes, les cellules sont bombardées de microparticules d'or à grande vitesse ou
tungstène recouvert d'ADN appelé biolistique ou méthode de canon à gènes.
(c) Des vecteurs pathogènes désarmés lorsqu'il est autorisé à infecter la cellule, transférer l'ADN recombinant dans l'hôte.62. (i) A l'aide de schémas, montrez les différentes étapes de la formation d'ADN recombinant par action de l'enzyme endonucléase de restriction Eco RI.
(ii) Nommer la technique utilisée pour séparer les fragments d'ADN coupés par les endonucléases de restriction. [Toute l'Inde 2011]
Rép. (i) Formation d'ADN recombinant par l'action de l'enzyme endonucléase de restriction Eco Rl.
L'enzyme de restriction coupe les deux brins d'ADN au même site, produisant des extrémités collantes.
(a) Les enzymes de restriction coupent le brin d'ADN un peu à l'écart du centre des sites palindromes, mais entre les deux mêmes bases sur les brins opposés.
(b) Cela laisse des portions simple brin aux extrémités.
(c) Il y a des tronçons en surplomb appelés extrémités collantes sur chaque brin, comme indiqué dans la figure ci-dessus. Ceux-ci sont nommés ainsi, car ils forment des liaisons hydrogène avec leurs homologues coupés complémentaires.
(d) Le caractère collant des extrémités facilite l'action de l'enzyme ADN ligase.
(e) Les endonucléases de restriction sont utilisées en génie génétique pour former des molécules recombinantes d'ADN, qui sont composées d'ADN provenant de différentes sources/génomes.
(f) Ces extrémités collantes sont complémentaires les unes des autres lorsqu'elles sont coupées par la même enzyme de restriction, elles peuvent donc être jointes (bout à bout) à l'aide d'ADN ligases.
(ii) Electrophorèse sur gel.

63. (i) Pourquoi les vecteurs modifiés sont-ils préférés par les biotechnologistes pour transférer les gènes souhaités dans un autre organisme ?(ii) Expliquez comment l'ori, le marqueur sélectionnable et les sites de clonage facilitent le clonage dans un vecteur ? [Étranger 2009]
Rép. (I) Les vecteurs modifiés sont préférés par les biotechnologistes car ils facilitent la liaison de l'ADN étranger et la sélection de recombinants à partir de non-recombinants.
(II) Les caractéristiques qui facilitent le clonage du vecteur sont :
(je) Origine de la réplication (Ou Je)

  • C'est la séquence d'ADN à partir de laquelle la réplication commence.
  • Tout morceau d'ADN étranger/étranger qui lui est lié est fait pour se répliquer dans la cellule hôte. Il décide également du nombre de copies de l'ADN lié.

(ii) Marqueur sélectionnable est un gène marqueur, qui aide à sélectionner les cellules hôtes, qui sont des transformants/recombinants des non-recombinants.
Par exemple, les gènes résistants à l'ampicilline et à la tétracycline dans £. coli.
(iii) Le site de clonage est un site de reconnaissance unique dans un vecteur pour lier l'ADN étranger. La présence d'un site de clonage/reconnaissance particulier aide l'enzyme de restriction particulière à couper l'ADN vecteur. Un site de reconnaissance unique est généralement préféré.
(iv) Petite taille du vecteur La petite taille facilite l'introduction de l'ADN dans l'hôte facilement.


Comment le site de restriction d'EcoRI a-t-il été séquencé ? - La biologie

Restriction sites, ou restriction sites de reconnaissance, sont des séquences spécifiques de nucléotides qui sont reconnues par restriction enzymatiques. Les sites sont généralement palindromes, et un restriction enzyme peut couper la séquence entre deux nucléotides à l'intérieur de son.
Article complet >>>

UNE restriction enzyme est une enzyme qui coupe l'ADN double brin ou simple brin à des séquences nucléotidiques de reconnaissance spécifiques connues sous le nom de restriction des sites. On pense que de telles enzymes, trouvées dans les bactéries et les archées, ont.
Article complet >>>

Comment puis-je ajouter un Placer à Internet Explorer Limité Des sites Zone? . Parce que nous parlons de la Limité Des sites zone que vous voudrez probablement.
Article complet >>>

Trouvailles restriction clivage par endonucléase des sites dans les séquences d'ADN. Prend en charge l'ADN linéaire et circulaire et offre plusieurs façons de trier et de filtrer la sortie.
Article complet >>>

CLC bio propose une large gamme de solutions bioinformatiques de classe mondiale : De l'analyse de séquences très avancée . interactif restriction placer une analyse .
Article complet >>>

CLC bio propose une large gamme de solutions bioinformatiques de classe mondiale : De l'analyse de séquences très avancée . Restriction placer détection. Inverser .
Article complet >>>

. zones dans Microsoft Internet Explorer et comment configurer différents niveaux de sécurité pour le Web des sites que vous visitez. . placer à la Limité Des sites zone, .
Article complet >>>

Indique restriction des sites d'enzymes Fermentas qui sont sensibles (clivage . Il n'y a pas restriction des sites dans l'ADN de PhiX174 pour les enzymes suivantes : .
Article complet >>>

Indique restriction des sites d'enzymes Fermentas qui sont sensibles (clivage . Il n'y a pas restriction des sites dans l'ADN de M13mp18 pour les enzymes suivantes : .
Article complet >>>

restriction placer synonymes, restriction placer antonymes. Des informations sur restriction placer . restriction-placer polymorphisme. Restriction. restrictionnisme.
Article complet >>>

Limité Placer. Cette placer est à l'usage du personnel du Northeast Georgia Council, Boy . informations confidentielles ou privées contenues sur ce site placer. .
Article complet >>>

Cet article fournit des détails sur le blocage des publicités indésirables, des bannières, des fenêtres contextuelles, des parasites, des pirates de l'air et des moteurs de recherche, en les plaçant dans le Limité Zone
Article complet >>>

Analyse des séquences dégénérées restriction cartes de séquences. Veuillez indiquer comment vous souhaitez que le restriction des sites affiché. Carte de restriction des sites .
Article complet >>>

Vous pouvez consulter notre liste de limité des sites est très grand. . Ajoutons un placer à la Limité Des sites liste. Notez le format de l'entrée. .
Article complet >>>

Comment les surfeurs trouvent leur chemin en temps de guerre pour limité ou censuré des sites . Les deux ont limité versions gratuites. Ces des sites cachez votre position et protégez-vous.
Article complet >>>

Des sites placé dans la zone de haute sécurité sera alors limité dans l'accès. Vous êtes protégé si un placer est dans votre limité zone. .
Article complet >>>

La longueur de restriction reconnaissance des sites varie : Les enzymes EcoRI, SacI et . Différent restriction les enzymes peuvent avoir la même reconnaissance placer - de telles enzymes .
Article complet >>>


Régulateurs de la signalisation des protéines G, partie B

Patrizia Tosetti , Kathleen Dunlap , dans Methods in Enzymology , 2004

Production de rétrovirus compétents pour la réplication.

Un 5′ Xba I site de restriction (TCT AGA) suivi d'une séquence accessoire de traduction/transcription (CCA CGT TGG CCA GGC GGT AGC TGG GAC GTG CAG CCG ACC ACC) et d'un épitope 3' HA (TAC GAC GTG CCC GAC TAC GCC) suivi d'un arrêt codon (TAG) et un HinLes sites de restriction dIII (AAG CTT) sont modifiés en cadre dans des ADNc variants de RGS3 par PCR, en utilisant des amorces portant les séquences appropriées. Les produits de PCR sont ensuite digérés et sous-clonés en cadre dans le XbaJE/Hinsites dIII du plasmide adaptateur Cla12 NCO. Les séquences d'intérêt sont ensuite excisées du plasmide adaptateur par ClaI digestion et sont sous-clonés de manière non directionnelle dans le ClaI site des variantes rétrovirales RCASBP du sous-groupe B (les deux plasmides étaient un don généreux du Dr Donna Fekete, Purdue University, West Lafayette, IN). Toutes les ligatures sont effectuées à l'aide du kit de ligature d'ADN rapide de Boehringer Mannheim (Indianapolis, IN), selon les instructions du fabricant. Les enzymes de restriction proviennent de New England Biolabs (Beverly, MA). Les constructions correctement orientées sont identifiées par PCR et séquençage.


Vous pouvez également filtrer les enzymes par où ou combien de fois elles coupent sur la séquence. Par exemple, vous pouvez filtrer pour ne voir que les enzymes qui sont des coupeurs simples ou doubles. Vous pouvez également voir des enzymes qui coupent n'importe où en dehors de votre sélection actuelle.

Cliquez à nouveau sur l'icône des ciseaux pour fermer le panneau Digests. Double-cliquez sur un site coupé sur la carte de séquence et notez que le panneau s'ouvre automatiquement pour afficher plus d'informations sur l'enzyme.


Auto-immunité bactérienne due à un système de restriction-modification

Les systèmes de restriction-modification (RM) représentent un système biologique minimal et omniprésent de discrimination auto/non auto chez les procaryotes [1], qui protège les hôtes de l'ADN exogène [2]. Le mécanisme est basé sur l'équilibre entre la méthyltransférase (M) et l'endonucléase de restriction apparentée (R). M marque l'ADN endogène en tant que soi en méthylant de courtes séquences d'ADN spécifiques appelées sites de restriction, tandis que R reconnaît les sites de restriction non méthylés comme non-soi et introduit une rupture d'ADN double brin [3]. Les sites de restriction sont significativement sous-représentés dans les génomes procaryotes [4-7], suggérant que le mécanisme de discrimination est imparfait et conduit parfois à une auto-immunité due au clivage de l'auto-ADN (auto-restriction) [8]. De plus, les systèmes RM peuvent favoriser la recombinaison de l'ADN [9] et contribuer à la variation génétique des populations microbiennes, facilitant ainsi l'évolution adaptative [10]. Cependant, le clivage de l'auto-ADN par les systèmes RM en tant qu'éléments façonnant les génomes procaryotes n'a pas été directement détecté, et sa cause, sa fréquence et son résultat sont inconnus. Nous quantifions l'auto-restriction causée par deux systèmes RM d'Escherichia coli et constatons que, en accord avec les niveaux d'évitement des sites de restriction, EcoRI, mais pas EcoRV, clive l'auto-ADN à un taux mesurable. L'auto-restriction est un processus stochastique, qui induit temporairement la réponse SOS, et est suivi d'une réparation de l'ADN, maintenant la viabilité cellulaire. Nous constatons que les systèmes RM avec une efficacité de restriction plus élevée contre les infections bactériophages présentent un taux d'auto-restriction plus élevé, et que ce taux peut être encore augmenté par un déséquilibre stochastique entre R et M. Nos résultats identifient le bruit moléculaire dans les systèmes RM comme un facteur de formation des procaryotes génomes.


Fréquences des sites de restriction

Le tableau ci-dessous résume les fréquences avec lesquelles les sites d'endonucléase de restriction apparaissent dans les molécules d'ADN couramment utilisées. Des cartes de restriction détaillées peuvent être trouvées sur les séquences et les cartes d'ADN. Les sites répertoriés dans ces tableaux ont été identifiés par analyse informatique des séquences publiées. Bien que nous ayons essayé de nous assurer de leur exactitude, les sites n'ont pas nécessairement été confirmés par l'expérimentation. Lorsque la même spécificité est affichée par plusieurs enzymes, le site est répertorié par le nom de l'enzyme disponible auprès de New England Biolabs. D'autres enzymes ayant la même spécificité sont répertoriées dans le tableau des isoschizomères. Les séquences de reconnaissance sont écrites 5´ à 3´.

DNASU est un référentiel central pour les clones et les collections de plasmides qui peuvent également être utiles.

Enzyme Séquence de reconnaissance Adéno-2 Lambda** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNN/NNNNNNNNNG
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI CTGAAG (16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
ÂgeI § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AhdI GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNTGG 10 20 1 0 1 0 1 0 2 0 8
AluI AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
Apai GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
ApALI G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BanI G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF ® GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC (8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCCAT(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC (6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI CGV(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/ÉTIQUETTE 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/AGCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG (16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG (16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI Avec CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI CCCACG(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI GTGCAG (16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF ® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI CGV(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC (10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GACY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF ® GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG (10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI AG/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaI Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
oreilleI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI BAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG (25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § CAG/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® CAG/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI /CATG 183 181 14 26 38 23 21 23 31 11 148
FauI CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI CC (12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC (5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
KasI G/GCCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI CCDG (10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGGCT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGGCT 5 7 0 0 0 1 2 2 1 0 1
MlyI GAGTC (5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC (20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI T/AAT 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
NonI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI RCATG/O 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI CGV(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PCII A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/CCGGCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
Rsal GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexeIA A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/RGT 0 1 1 0 1 0 1 0 0 0 13
SpéI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
Swai ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
Noël C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZrI CAG/CG 3 10 0 1 0 0 5 1 0 1 1

§ Une version HF de cette enzyme est disponible.

* Pour M13mp18, seules les régions double brin seront coupées.
** Fait référence au substrat d'ADN de type sauvage. Hind III a 6 sites de restriction sur l'ADN du phage lambda de type sauvage, tandis que le mutant du phage lambda de NEB (ADN Lambda, NEB #N3011) a 7 sites Hind III.


Fréquences des sites de restriction

Le tableau ci-dessous résume les fréquences avec lesquelles les sites d'endonucléase de restriction apparaissent dans les molécules d'ADN couramment utilisées. Des cartes de restriction détaillées peuvent être trouvées sur les séquences et les cartes d'ADN. Les sites répertoriés dans ces tableaux ont été identifiés par analyse informatique des séquences publiées. Bien que nous ayons essayé de nous assurer de leur exactitude, les sites n'ont pas nécessairement été confirmés par l'expérimentation. Lorsque la même spécificité est affichée par plusieurs enzymes, le site est répertorié par le nom de l'enzyme disponible auprès de New England Biolabs. D'autres enzymes ayant la même spécificité sont répertoriées dans le tableau des isoschizomères. Les séquences de reconnaissance sont écrites 5´ à 3´.

DNASU est un référentiel central pour les clones et les collections de plasmides qui peuvent également être utiles.

Enzyme Séquence de reconnaissance Adéno-2 Lambda** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNN/NNNNNNNNNG
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI CTGAAG (16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
ÂgeI § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AhdI GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNTGG 10 20 1 0 1 0 1 0 2 0 8
AluI AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
Apai GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
ApALI G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BanI G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF ® GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC (8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCCAT(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC (6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI CGV(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/ÉTIQUETTE 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/AGCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG (16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG (16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI Avec CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI CCCACG(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI GTGCAG (16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF ® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI CGV(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC (10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GACY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF ® GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG (10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI AG/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaI Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
oreilleI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI BAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG (25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § CAG/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® CAG/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI /CATG 183 181 14 26 38 23 21 23 31 11 148
FauI CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI CC (12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC (5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
KasI G/GCCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI CCDG (10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGGCT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGGCT 5 7 0 0 0 1 2 2 1 0 1
MlyI GAGTC (5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC (20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI T/AAT 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
NonI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI RCATG/O 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI CGV(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PCII A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/CCGGCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
Rsal GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexeIA A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/RGT 0 1 1 0 1 0 1 0 0 0 13
SpéI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
Swai ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
Noël C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZrI CAG/CG 3 10 0 1 0 0 5 1 0 1 1

§ Une version HF de cette enzyme est disponible.

* Pour M13mp18, seules les régions double brin seront coupées.
** Fait référence au substrat d'ADN de type sauvage. Hind III a 6 sites de restriction sur l'ADN du phage lambda de type sauvage, tandis que le mutant du phage lambda de NEB (ADN Lambda, NEB #N3011) a 7 sites Hind III.


Voir la vidéo: Biologie moléculaire 2les Enzymes de Restriction. أنزيمات التقطيع (Février 2023).