Informations

Comment étudier l'effet des isoformes de la protéine tau sur le transport basé sur les microtubules ?

Comment étudier l'effet des isoformes de la protéine tau sur le transport basé sur les microtubules ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

D'après ce que j'ai lu, les plaques A-bêta inhibent le transport des mitochondries basé sur les microtubules lorsque la protéine tau est présente dans la cellule. Comment pourrais-je faire un test pour voir si une isoforme de tau est plus efficace pour conférer cette sensibilité A-bêta qu'une autre isoforme ?


Vous pouvez effectuer un test basé sur la microscopie pour quantifier le taux de transport (à la fois rétrograde et antérograde). Les mitochondries peuvent être marquées avec des protéines fluorescentes telles que mito-dsRed, et son mouvement le long de l'axone peut être suivi par imagerie de cellules vivantes. Vous pouvez vérifier ce papier ; ils ont fait cette expérience. (D'autres l'ont fait aussi mais je me souviens de ce papier car quelqu'un m'en a parlé récemment).

Comment envisagez-vous de voir l'effet des différentes isoformes ? Ce n'est peut-être pas si facile. Vous devrez remplacer l'isoforme commune par les autres. Il n'est pas très facile de contrôler l'épissage. Vous devrez donc peut-être faire des lignes qui expriment une seule variante (suppression d'exons). Bien que cette étude rapporte que l'épissage alternatif peut être contrôlé en utilisant des oligonucléotides antisens, la technologie n'est pas encore standardisée ; vous pouvez quand même l'essayer, car faire des knock-out est difficile (il faudrait faire des souris KO puis cultiver des neurones à partir de celles-ci).


Rôle de la région Tau N-terminale dans la stabilisation des microtubules révélé par les nouvelles formes tronquées endogènes

Tau est un acteur central dans la maladie d'Alzheimer (MA) et les tauopathies apparentées, où il se trouve sous forme d'agrégats dans les neurones en dégénérescence. Des modifications post-traductionnelles anormales, telles que la troncature, sont probablement impliquées dans le processus pathologique. Une avancée majeure dans la compréhension du rôle de la Tautruncation serait d'identifier les sites de clivage précis des plusieurs fragments de Tau tronqués qui sont observés jusqu'à présent dans les cerveaux AD, en particulier ceux tronqués à l'extrémité N-terminale, qui sont moins caractérisés que ceux tronqués à la C- terminus. Ici, nous avons optimisé une approche protéomique et réussi à identifier un certain nombre de nouvelles espèces Tau tronquées à l'extrémité N du cerveau humain. Nous avons lancé des études fonctionnelles cellulaires en analysant les caractéristiques biochimiques de deux espèces Tau tronquées à l'extrémité N commençant respectivement aux résidus Met11 et Gln124. Nos résultats montrent, de manière intéressante, que le fragment Gln124-Tau affiche une capacité plus forte à se lier et à stabiliser les microtubules, suggérant que le domaine TauN-terminal pourrait jouer un rôle direct dans la régulation de la stabilisation des microtubules. Des études futures basées sur notre nouvelle espèce Tau N-terminalement tronquée devraient améliorer notre connaissance du rôle de la troncature dans la biologie de Tau ainsi que dans le processus pathologique de la MA.


INTRODUCTION

La maladie d'Alzheimer (MA) est une maladie neurodégénérative chronique qui se caractérise cliniquement par un déclin progressif des fonctions cognitives, conduisant à la démence. La maladie conduit finalement à la mort des personnes atteintes en moyenne neuf ans après le diagnostic [1]. Environ 27 millions de personnes souffrent de la MA dans le monde, et cela représente la majorité des cas de démence chez les adultes. Au cours des trois dernières décennies, les traitements standard de la MA ont été les inhibiteurs de l'acétylcholinestérase pour améliorer la fonction cognitive et d'autres médicaments pour gérer les troubles de l'humeur, l'agitation et la psychose qui surviennent souvent dans les derniers stades de la maladie. Ces dernières années, la mémantine, un antagoniste des récepteurs NMDA (Nméthyl-D-aspartate) et un agent potentiellement neuroprotecteur, a été largement utilisée. Cependant, tous ces traitements ne montrent que des effets symptomatiques modestes. Le principal obstacle à des traitements efficaces est le manque de compréhension complète du mécanisme de la MA.

Les deux dernières décennies ont marqué une ère très importante de la recherche sur la MA. Au cours de cette période, la nature des plaques amyloïdes et des enchevêtrements neurofibrillaires (NTF), les deux caractéristiques histopathologiques de la MA, a été élucidée. Des efforts de recherche récents ont conduit à plusieurs hypothèses pour expliquer la MA. En conséquence, de nombreux nouveaux médicaments thérapeutiques pour la MA sont à divers stades de développement. Une recherche sur Internet sur la maladie d'Alzheimer sur le site Web du NIH 𠇌linicalTrials.gov” (http://www.clinicaltrials.gov) a abouti à 180 essais en cours d'études interventionnelles sur la MA au moment de cette préparation de manuscrit. Comme certaines des voies moléculaires impliquées dans la pathogenèse de la MA ont été révélées, il est temps de développer un traitement modificateur de la maladie pour la MA.

On pense que la toxicité de l'amyloïde β (Aβ) joue un rôle primordial dans le développement de la MA [2]. Ainsi, les stratégies anti-amyloïdes ont été au centre du développement de médicaments contre la MA au cours des 10 dernières années. Récemment, de plus en plus de preuves ont démontré un rôle crucial des anomalies de tau dans la neurodégénérescence de la MA, suggérant que la tau pourrait être une cible thérapeutique prometteuse pour le développement de médicaments modificateurs de la maladie de la MA. Dans cet article, nous décrivons d'abord la protéine tau et les anomalies tau impliquées dans la MA, suivies du mécanisme moléculaire de la dégénérescence neurofibrillaire. Ensuite, nous discutons des stratégies thérapeutiques basées sur l'inversion de l'hyperphosphorylation anormale de tau.


MATÉRIAUX ET MÉTHODES

Construction de constructions de fusion GFP-tau

Les constructions tau humaines dépourvues des exons 2 et 3 ont été aimablement fournies par le Dr Michael Hutton. Les constructions 3R (exon 10-), 4R (exon 10+), 4R P301L, 4R V337 M et 4R R406W ont été clonées dans le vecteur pBluescript KS- (Strategene, La Jolla, CA). Pour fabriquer des constructions de fusion GFP-tau, tau-4R de type sauvage a été amplifié à partir de la méthionine 5'-fin (Bglsite II) au codon stop 3' (Écosite RI) sur le vecteur pBluescript KS -. Le fragment PCR a été ligaturé dans un vecteur PCR-Blunt (Invitrogen, Carlsbad, CA). Le vecteur PCR Blunt avec tau-4R a été digéré avec BglII et ÉcoRI et ligaturé dans le BglII/ÉcoSites RI du vecteur pEGFP-C1 (Clontech, Palo Alto, CA). Cette construction codait pour une EGFP fusionnée à son extrémité carboxy à l'extrémité amino de tau. pEGFPC1–4Rtau ont été coupés avec SacII et SmaI. L'isoforme Tau 3R et les mutants 4R P301L, 4R V337 M et 4R R406W dans le vecteur pBluescript KS − ont été digérés avec SacII et SspI et ligaturé dans le SacSites II et Sma de pEGFPC1–4R. Pour transférer les isoformes et les mutants de tau dans ECFP (protéine fluorescente cyan améliorée) ou EYFP (protéine fluorescente jaune améliorée Clontech), les constructions pEGFP-tau digérées avecBamBonjour et BglII ont été ligaturés soit dansBamHI et/ou BglII sites de l'ECFP et de l'EYFP. Toutes les constructions ont été séquencées. Les constructions pCMV-p25, pCMV-CDK5 et pCMV-DNCDK5 (le DN est le négatif dominant) ont été aimablement fournies par le Dr L. Tsai. La construction EGFP-tubuline provenait de Clontech.

Cultures cellulaires et transfection

Des cellules NIH 3T3 ont été cultivées dans du milieu DMEM supplémenté avec 10 % de sérum bovin foetal sur des lamelles de 25 mm placées dans des plaques 6 puits. Un jour après l'étalement, les cellules ont été transfectées avec diverses constructions d'ADN en utilisant des kits de transfection Superfect (Qiagen, Chatsworth, CA) selon le protocole du fabricant. Plus précisément, pour chaque lamelle, 1 à 4 µg d'ADN (2 µg pour la transfection simple et 2 à 4 µg pour la double transfection) ont été mélangés à 100 µl de milieu, puis 10 µl de Superfect ont été ajoutés à la solution. Après 10 min de précipitation, le mélange a été ajouté sur les cellules, qui ont été incubées à 37°C pendant 2 h, puis lavées avec du PBS et du milieu normal, et remises dans l'incubateur. Les transfections avec l'une des isoformes EGFP-tau, pCMV-P25 et PCMV-CDK5 ou pCMV-DNCDK5, ont été réalisées en mélangeant 1 µg d'ADN de chaque construction pour chaque lamelle et analysées 2 jours après la transfection.

Immunocytochimie et immunotransfert

Deux jours après la transfection, les cellules ont été fixées à l'aide d'un protocole combiné de fixation et d'extraction (Lee, 1997) (0,3 % de glutaraldéhyde, 0,5 % de NP40, 80 mM de PIPES/KOH, pH 6,8, 5 mM d'EGTA et 1 mM de MgCl2) à 37°C pendant 10 min. Après traitement avec NaBH4 et glycine et bloquant avec 5% de sérum de chèvre, les cellules ont été incubées dans de l'anti-α-tubuline de souris (1:2000, Sigma, St. Louis, MO) à 4°C pendant la nuit. Les cellules ont ensuite été lavées et incubées avec des anticorps secondaires de chèvre anti-souris conjugués au rouge Texas (1:100 Jackson ImmunoResearch Laboratory, West Grove, PA) à température ambiante pendant 1 h. Des lamelles ont été montées pour la microscopie à fluorescence.

Pour l'extraction de tau non associé au cytosquelette, les lamelles ont d'abord été rincées avec du PBS, puis rincées avec du tampon d'extraction (80 mM PIPES/KOH, pH 6,8, 1 mM MgCl2, 1 mM d'EGTA, 30 % de glycérol, 1 mM de GTP). Les cellules ont ensuite été extraites avec 0,1% de Triton X-100 dans le tampon d'extraction pendant 30 s. Les cellules ont été fixées avec du glutéraldéhyde comme ci-dessus, mais sans 0,5% de NP40, après avoir été rincées avec du tampon d'extraction et du PBS. Tous les traitements ont été effectués à 37°C. Des lamelles ont ensuite été montées et une microscopie à fluorescence a été réalisée. Pour augmenter le pool de tau associé non cytosquelettique, les cellules ont été perfusées sur scène avec du nocadozole (165 M) pendant différentes durées.

Pour l'immunotransfert, les cellules transfectées ont été grattées dans 1% NP40/1 % Triton plus le cocktail d'inhibiteur de protéase, Complete (Boehringer Mannheim, Indianapolis, IN) dans PEM (80 mM PIPES, 5 mM EGTA, 1 mM MgCl2, pH 6,8) et incubé 20 min à 4°C. Les extraits ont été centrifugés à basse vitesse (13 000 ×g) pendant 5 min à 4°C. Pour distinguer les isoformes tau par immunoblot, les échantillons ont été déphosphorylés avec de la phosphatase intestinale de veau (CIP). Le lysat (13,5 pl) a été incubé avec du CIP à une concentration finale de 275 U/ml à 37°C pendant une nuit. Les échantillons ont été analysés dans des gels de Tris-glycine à 8 % et transférés sur de la nitrocellulose. Les membranes ont d'abord été bloquées avec 5% de lait dans du TBS/0,1% Tween-20, incubées avec l'anticorps primaire 5E2 (1:500) pendant 1 h à température ambiante, puis incubées avec des anticorps secondaires de chèvre anti-souris conjugués à HRP (1 :10 000) pendant 1 h à température ambiante. Les signaux ont été détectés en utilisant Supersignal West Pico Chemiluminescent (Pierce, Rockford, IL). Les films exposés (Eastman Kodak, Rochester, NY) ont été numérisés dans Adobe PhotoShop (San Jose, CA). Les images ont été traitées et imprimées directement sur une imprimante couleur Kodak (modèle 8650 PS Kodak Digital Science).

Microscopie vidéo à fluorescence

La microscopie vidéo à fluorescence haute résolution pour les cellules transfectées avec des constructions de fusion GFP-tau a été réalisée sur un microscope Nikon (Diaphot 300 Garden City, NY) équipé à la fois d'une lentille à immersion dans l'huile 40× (1,0 NA) et d'une lentille à immersion dans l'huile 100× (1,4 NA ). L'ensemble de filtres GFP spécifique (Chroma Tech, Brattleboro, VT) a été utilisé pour détecter la fluorescence de la protéine de fusion EGFP-tau. Pour visualiser les cellules doublement marquées avec des protéines de fusion ECFP (Ex : 433 nm, Em : 475 nm) et EYFP (Ex : 513 nm, Em : 527 nm), des filtres spécifiques ont été placés dans l'excitation commandée par ordinateur correspondante (ECFP : 436DF10 , EYFP : 485DF15) et roues à filtres d'émission (ECFP : 475DF30, EYFP : 530DF30) pour obtenir des images rapidement. Les images de fluorescence ont ensuite été capturées avec une caméra CCD très sensible, amincie et refroidie (Princeton Instrument, Roper Scientific, Trenton, NJ) et traitées à l'aide du logiciel Metamorph (Universal Imaging, West Chester, PA) et Adobe PhotoShop. Pour minimiser le photoblanchiment et la phototoxicité, en particulier pour les cellules vivantes, l'obturateur automatique commandé par ordinateur a été utilisé pour obtenir l'éclairage minimum. Les images ont été capturées pendant 1 minute de temps d'exposition, sauf indication contraire. Dans la mesure du possible, des filtres à densité neutre ont été utilisés.

Traitement d'imagerie et analyse quantitative

Le logiciel Metamorph (version 3.5) a été utilisé pour le traitement des images. Pour la soustraction de fond, la valeur moyenne de gris de fond de l'image en cours d'analyse (y compris la tension de polarisation et le courant d'obscurité) a été soustraite. Pour améliorer davantage les images, la fonction de masquage flou a été appliquée et un codage couleur a été utilisé pour la présentation des couleurs. Dans les cellules doublement marquées avec ECFP et EYFP, deux images capturées individuellement à partir des canaux ECFP et EYFP ont été superposées. Une analyse par balayage linéaire a démontré la différence quantitative d'intensité de fluorescence. Pour présenter des images avec Adobe PhotoShop, les images 12 bits capturées ont été converties en images 8 bits. Après avoir été traitées avec Adobe PhotoShop, les images ont été imprimées directement sur une imprimante couleur Kodak (modèle 8650 PS Kodak Digital Science).

Une analyse statistique du signal fluorescent dérivé des microtubules par rapport aux régions sans microtubules de la cellule a été réalisée pour chaque paire de construction. Toutes les images ont été soustraites de l'arrière-plan en calculant une intensité moyenne dans trois régions d'arrière-plan de 40 × 40 pixels sélectionnées au hasard, et l'intensité moyenne des trois valeurs a été soustraite de l'image. Pour chaque paire d'images doublement marquées, deux cases ont été dessinées sur les images EYFP : une case contenait un microtubule (Y2) et l'autre case était juste à côté du microtubule (Y1) (voir Figure 8A). La fonction « régions de transfert » a ensuite été utilisée pour décrire les zones correspondantes dans les images étiquetées ECFP de la même cellule (C2 et C1). L'intensité moyenne de chacune des quatre cases a été mesurée avec la fonction « afficher les statistiques de la région » et connectée à Excel. Neuf paires de constructions différentes ont été analysées (voir figure 8B). Pour chaque paire de constructions, 5 à 7 cellules ont été analysées et 9 à 10 microtubules (quatre boîtes pour chaque analyse) ont été analysés dans chaque cellule. Au total, 1848 points de données ont été collectés. Un rapport des intensités de fluorescence normalisées (indice de fluorescence) a été calculé en utilisant l'équation représentée sur la figure 8A. La question de savoir si les différences dans les valeurs des indices étaient significatives a été déterminée avec un t test.

Cytométrie en flux

Deux jours après la transfection, les cellules ont été suspendues dans du PBS et la cytométrie en flux a été réalisée dans l'installation de cytométrie en flux du Dana-Faber Cancer Institute sur un FACS Bantage (Becton Dickinson Immunocytometry Systems, Mountain View, CA) avec le logiciel Cellquest.


Résumé

Les mutations de FTDP-17 dans le gène tau conduisent à des démences frontotemporales d'apparition précoce caractérisées par l'agrégation pathologique de la protéine tau associée aux microtubules. L'agrégation de Tau est étroitement corrélée à la progression et à la gravité de l'atrophie localisée de certaines régions du cerveau. Ces mutations sont principalement situées dans ou à proximité des régions répétées de liaison aux microtubules de tau et peuvent avoir des effets très différents sur la protéine. Certaines mutations ont été liées à des effets tels que des niveaux accrus d'agrégation, une hyperphosphorylation, des défauts d'épissage de l'ARNm et une interaction affaiblie avec les microtubules. Compte tenu des effets différentiels des mutations, il n'est peut-être pas surprenant que la pathologie associée au FTDP-17 puisse également varier considérablement. Malgré cette variété, plusieurs des mutations sont couramment utilisées de manière interchangeable comme inducteurs d'agrégation pour les modèles in vitro et in vivo de tauopathies. Nous avons généré des formes recombinantes de 12 mutations FTDP-17 choisies pour leurs effets prédits sur la charge, l'hydrophobie et la structure secondaire de la protéine. Nous avons ensuite examiné les effets des mutations sur les propriétés d'agrégation in vitro de la protéine et sa capacité à stabiliser l'assemblage des microtubules. Le groupe de mutations a induit des effets très différents sur la quantité totale d'agrégation, la cinétique d'agrégation et la morphologie des filaments. Plusieurs des mutations ont inhibé la capacité de stabilisation des microtubules du tau, tandis que d'autres ont eu très peu d'effet par rapport au tau de type sauvage. Ces résultats indiquent que les mécanismes de progression de la maladie peuvent différer parmi les mutations de FTDP-17 et que les effets des différentes mutations peuvent ne pas être égaux dans tous les systèmes modèles.


La protéine Tau associée aux microtubules et sa pertinence pour les cellules bêta du pancréas

Les altérations structurelles et biochimiques de la protéine tau associée aux microtubules (MAPT) sont associées à des troubles dégénératifs appelés tauopathies. Nous avons déjà montré que MAPT est présent dans des îlots humains de Langerhans, des insulinomes humains et des modèles de lignées de cellules bêta pancréatiques, avec des similitudes biophysiques avec le MAPT pathologique dans le cerveau. Ici, nous avons étudié plus en détail MAPT dans le tissu endocrinien pancréatique pour mieux comprendre les mécanismes qui conduisent à une dérégulation fonctionnelle des cellules bêta pancréatiques. Nous avons trouvé une régulation à la hausse de l'expression de la protéine MAPT dans les insulinomes humains par rapport aux îlots pancréatiques humains de Langerhans et un déséquilibre entre les isoformes MAPT dans le tissu des insulinomes. Nous avons cloné un MAPT à 3 domaines répétés et l'avons transduit dans une lignée cellulaire de rongeur dérivée de cellules bêta Rin-5F. Des expériences de prolifération ont montré des taux de croissance et des activités métaboliques plus élevés des cellules surexprimant la protéine MAPT. Nous avons observé qu'une lignée cellulaire surexprimant MAPT présente des taux de transcription, de traduction et de sécrétion d'insuline modifiés. Nous avons trouvé que les taux relatifs de sécrétion d'insuline étaient significativement diminués dans une lignée cellulaire surexprimant MAPT et ces résultats ont pu être confirmés en utilisant des lignées cellulaires knock-down partielles de MAPT. Nos résultats soutiennent que MAPT peut jouer un rôle important dans le trafic des granules d'insuline et indiquent l'importance de la phosphorylation et de la déphosphorylation équilibrées de MAPT pour une libération adéquate d'insuline.

1. Introduction

Les cellules neuroendocrines pancréatiques sont situées dans les îlots de Langerhans et sont impliquées dans le métabolisme du glucose chez les mammifères régulant ainsi la glycémie. D'une part, la perte de cellules bêta pancréatiques, observée dans le diabète sucré de type 1 et dans les stades avancés du diabète sucré de type 2, entraîne une diminution de la production d'insuline. D'autre part, la prolifération incontrôlée des cellules neuroendocrines pancréatiques dans les tumeurs neuroendocrines pancréatiques (PanNET) entraîne une sécrétion hormonale inadéquate [1]. Les PanNETs sont rares, représentant moins de 5 % des néoplasies pancréatiques, mais elles représentent une forme clinique importante de pancréatite [2]. Les PanNETs les plus courantes sont les insulinomes avec une incidence annuelle de 1 à 4 pour 1 000 000 [3]. Cependant, il a été suggéré que les insulinomes restent souvent non diagnostiqués au cours de la vie, car leur prévalence dans les études d'autopsie atteint jusqu'à 10 %. Les insulinomes surviennent dans les îlots de Langerhans et mesurent généralement moins de 2 cm de diamètre. Leur production accrue d'insuline entraîne fréquemment une hypoglycémie.

Bien que le diabète et les PanNETs représentent une extrémité opposée du spectre en ce qui concerne les niveaux de glucose dans le sang, le niveau d'insuline sécrétée est crucial dans les deux conditions.Par conséquent, l'élucidation des mécanismes et des molécules, qui jouent un rôle dans le contrôle de la synthèse et de la sécrétion d'insuline, est primordiale afin d'approfondir notre compréhension de la physiopathologie du diabète et des PanNETs.

Dans la présente étude, nous nous concentrons sur la protéine tau associée aux microtubules (MAPT). Avec MAP2 et MAP4 [4, 5], MAPT appartient à la famille des protéines associées aux microtubules, qui stabilisent les pistes des microtubules [6–8]. Les microtubules représentent les rails pour le trafic des vésicules des neurotransmetteurs vers les synapses [9] et pour la maturation des granules d'insuline, leur traitement et leur pré-amorçage pour l'exocytose [10-14]. MAPT est présent non seulement dans le système nerveux central (SNC) mais aussi dans le pancréas, le sein, la prostate et les tubules rénaux [15, 16] (http://www.proteinatlas.org/).

Les agrégats de MAPT anormalement hyperphosphorylés sont le constituant principal des enchevêtrements neurofibrillaires (NFT) et des fils neuropilaires (NT) qui sont des lésions neuropathologiques caractéristiques de la maladie d'Alzheimer (MA) [17, 18]. Fait intéressant, il a été récemment rapporté que MAPT anormalement hyperphosphorylé a été trouvé dans les îlots pancréatiques d'individus souffrant de diabète sucré de type 2 [19]. Dans notre étude précédente, nous avons décrit la biochimie de MAPT dans la lignée cellulaire de rongeurs dérivée de cellules bêta Rin-5F [20].

Motivé par ces résultats, une partie de la présente étude visait à évaluer les niveaux d'expression de MAPT dans les îlots pancréatiques humains et les insulinomes humains. Dans la deuxième partie, nous avons étudié la pertinence de la protéine MAPT pour les cellules bêta à l'aide d'un in vitro modèle de lignée cellulaire pancréatique.

Le processus de sécrétion d'insuline a été étudié dans des îlots isolés de rongeurs [21-23] et des lignées cellulaires d'insulinome dérivées de cellules bêta [24, 25]. Bien que le couplage entre le stimulus et la sécrétion soit perturbé dans la plupart des lignées cellulaires [26, 27], le mode de trafic des granules des granules immatures aux granules pré-amorcés et amorcés préparés pour la sécrétion pourrait être préservé. Le processus de maturation des granules tel que décrit pour les cellules bêta [28, 29] et le mouvement intracellulaire des vésicules contenant de l'insuline/transmetteur dépendent d'une machinerie microtubulaire fonctionnelle ainsi que de protéines motrices et de protéines associées aux microtubules telles que le MAPT [30].

La surexpression des isoformes MAPT humaines dans les neurones a été étudiée à l'aide de modèles animaux expérimentaux [31-33]. Ces études ont démontré que la surexpression de MAPT conduit à une axonopathie et a une influence sur la compartimentation de MAPT ainsi que sur l'hyperphosphorylation.

Par conséquent, dans la présente étude, nous avons cherché à étudier les effets de la surexpression de MAPT sur les taux de croissance des lignées cellulaires bêta pancréatiques et sur les taux de transcription, de traduction et de sécrétion d'insuline. Nous avons également examiné les effets de la suppression du MAPT endogène. Nos données indiquent l'importance des niveaux de MAPT et de l'état de phosphorylation de MAPT pour la biologie des cellules bêta pancréatiques.

2. Matériel et méthodes

2.1. Isolement d'ARN
2.1.1. Tissu d'îlots et d'insulinomes humains

L'ARN total a été isolé à partir de tissus d'insulinome humain conservés congelés après chirurgie dans de l'azote liquide. En bref, environ 50 à 100 mg de tissu tumoral ont été homogénéisés dans 1 ml de TRIzol (Invitrogen, Lofer, Autriche) et l'ARN total a été isolé par séparation de phases et précipitation avec de l'isopropanol en suivant les instructions des fabricants. L'ARN total des îlots pancréatiques humains a été obtenu auprès du Département de biochimie médicale et de génétique, Université de Copenhague (Danemark) (Professeur J. H. Nielsen). Une ??g d'ARN total ont été rétrotranscrits à l'aide de SuperScript II (Invitrogen) et d'amorces aléatoires et l'ADNc résultant a été dilué à 1 : 3 dans H2O. Il est à noter que cette partie de l'étude avait été approuvée par le comité d'éthique de l'Université de médecine de Vienne.

2.1.2. Lignée cellulaire de rongeur dérivée de cellules bêta pancréatiques Rin-5F

Nous choisissons la lignée cellulaire d'insulinome de rat, Rin-5F, un clone dérivé de la lignée d'îlots de rat Rin-m (ATTC CRL-2057), comme principal outil d'investigation pour in vitro une analyse. Cette lignée cellulaire représente un modèle pour étudier la biologie des cellules bêta pancréatiques, en particulier le mécanisme contrôlant la synthèse, le stockage et la sécrétion d'insuline.

Les lignées cellulaires Rin-5F ont été cultivées en milieu complet [20] et récoltées dans 900 ??L TRIzol. L'ARN et l'ADNc ont été traités et obtenus de la même manière que décrit ci-dessus.

2.2. RT-qPCR
2.2.1. Îlots humains et Insulinomes

Afin de mesurer toutes les isoformes MAPT dans les îlots pancréatiques humains et les insulinomes, nous avons conçu Panoramique CARTE amorces spécifiques : CARTE fw : (5′-CCTCTCCCGTCCCTCGCCTCTG-3′) et CARTE rv : (5'-GGGTCAGCCATCCTGGTTCA-3'). Une ??L d'ADNc d'îlot ou d'insulinome et cinq ??L du Master Mix PCR SYBR Green/RQX (SA Bioscience, réf. PA-012), avec 10 ??M Panoramique CARTE amorces, ont été utilisées pour mesurer les niveaux relatifs d'expression du gène MAPT. La RT-qPCR a été réalisée sur la machine PCR StepOnePlus et calculée à l'aide de la méthode ΔΔCT. L'actine a été utilisée comme gène domestique.

2.2.2. Lignée cellulaire de rongeur dérivée de cellules bêta pancréatiques Rin-5F

Pour évaluer les niveaux d'expression génique individuels, les sondes spécifiques à TaqMan d'Applied Biosystems (le CARTE, numéro : Hs00213487_m1 MAPT, Lot. : 471108 le rat CARTE, numéro : Rn01495715_m1, Lot. : 612900 le Rat Insuline, numéro : Rn02121433_g1 Ins1, Lot. : 771584), avec TaqMan 2xPCR Master Mix (Applied Biosystems, Lot. : N10545), ont été utilisés pour les mesures RT-qPCR sur la machine PCR StepOnePlus. Après normalisation des échantillons individuels en utilisant Gapdh (numéro : Rn01775763_g1 Gapdh, Lot. : 740946) et/ou Pdx1 (numéro : Rn00755591_m1 Pdx1, Lot. : 455683) comme gènes domestiques, les niveaux d'expression ont été calculés avec la méthode ΔΔCT en prenant comme standard le transfectant fictif ou la lignée de type sauvage.

2.3. PCR pour la différenciation des isoformes Tau 3RD versus 4RD

Pour différencier les isoformes MAPT à domaine à 3 répétitions (3RD) et à domaine à 4 répétitions (4RD) dans les îlots pancréatiques humains et les insulinomes, nous avons utilisé les amorces suivantes : HE9F2 (5′-ACCCAAGTCGCCGTCTTCCGCC-3′) et HE11R (5′-CACCTTGCTCAGGTCAACTGGT- 3′) spécifiques des exons 9 et 11, respectivement [34]. Ceci a révélé des produits PCR de 170 pb en excluant l'exon 10 (E10-, qui correspond aux isoformes 3RD MAPT) et de 256 pb en incluant l'exon 10 (E10+, qui correspond aux isoformes 4RD MAPT). Les conditions de PCR étaient de 35 cycles : 95°C, 68°C et 72°C avec une extension de 7 minutes à la fin, en utilisant une polymérase haute fidélité (Roche, Bâle, Suisse). Afin de mesurer le produit dans la phase d'amplification linéaire, la réaction PCR a été terminée entre les cycles 27 et 29. La séparation du produit a été effectuée sur un gel d'agarose à 1,5% et l'intensité de la bande a été quantifiée à l'aide de Lumi Imager F1 (Roche) et du programme Image J .

2.4. Clonage d'isoformes Tau humaines

L'ADNc humain (comme matrice) avec l'amorce directe 5′-ATGGCTGAGCCCCGCCAG-3′ et l'amorce inverse 5′-TCACAAACCCTGCTTGGCCA-3′ a été utilisé pour l'amplification de la région codante de l'homme CARTE. Les conditions de PCR étaient de 35 cycles : 95°C pour la dénaturation, 62,5°C pour l'annelage et 72°C pour la synthèse avec une extension de 7 min à la fin, en utilisant la polymérase haute fidélité (Roche). Le produit de PCR résultant a été analysé sur un gel d'agarose à 1%, les bandes spécifiques de MAPT ont été découpées et les amplicons d'ADN ont été liés à des billes de verre (à température ambiante, o/n sous rotation constante) (S&S Elu-Quik, Schleicher & Schuell , Allemagne). Après lavage, les billes de verre ont été séchées sous vide et l'ADN a été élue dans 50 ??L H2O (2 min à 50°C).

Les fragments d'ADN (3 ??L) ont été ligaturés dans le système vectoriel pGEM-T Easy en suivant les instructions du fabricant (Promega, Madison, WI, USA). Le produit de ligature (2 ??L) a été transformé en One Shot TOP10 Chimiquement Compétent E. coli (Invitrogen) avec la méthode du choc thermique suivant les instructions du fabricant et cultivé sur des plaques LB/Amp/X-gal (o/n à 37°C). Des colonies blanches ont été inoculées dans du milieu TY/Amp, cultivées pendant 16 h à 37°C, et les plasmides ont été isolés par la méthode miniprep (Qiagen) et les inserts ont été identifiés par digestion par enzymes de restriction (EcoR I) et le séquençage.

Pour l'ingénierie du vecteur d'expression protéique, une nouvelle amorce directe comprenant CACC à l'extrémité 5' a été conçue, et l'isoforme 3RD-MAPT3 codant le plasmide pGEM-T Easy a été choisie comme matrice. Le produit de PCR résultant a été cloné dans le vecteur pENTR/D-TOPO comme indiqué dans le manuel de test du fabricant (Life Technologies). Le vecteur recombinant a été transformé en One Shot TOP10 Chimiquement Compétent E. coli (Invitrogen) et cultivées o/n sur des plaques LB/Kanamycine. Les colonies en croissance ont été inoculées dans du milieu TY/Kanamycine, cultivées pendant 16 h, les plasmides ont été isolés par la méthode miniprep (Qiagen) et les inserts ont été identifiés par des enzymes de restriction en utilisant Hind III et Pas moi. Le clone d'entrée résultant a été utilisé pour transférer l'insert dans le vecteur d'expression/destination : pEXP1-DEST (Invitrogen). La réaction de clonase LR a été réalisée à 25°C comme indiqué dans le manuel de test (en bref : 2 ??L LR clonase II a été mélangé avec 150 ng de plasmide Tau pENTR/D-TOPO et 150 ng de vecteur pEXP1-DEST de type sauvage dans un volume total de 10 ??L) et transformées en cellules chimiquement compétentes en utilisant la méthode du choc thermique comme indiqué ci-dessus. Les colonies en croissance ont été inoculées dans du milieu TY, cultivées pendant 16 h à 37 °C. Le plasmide contenant l'insert a été vérifié (par digestion par enzyme de restriction Hind III), transformée en codon BL21 plus des bactéries, et clonée sur des plaques TY/Amp. Une seule colonie a été inoculée dans un erlenmeyer dans 25 ml de milieu TY/Amp o/n. Pour l'induction de l'expression des protéines, l'IPTG (100 ??M) a été ajouté (6 heures d'incubation à 31°C sous rotation constante). La culture bactérienne a été récoltée par centrifugation à 3200 tr/min pendant 12 min et le culot résultant a été lysé dans 4 M d'urée, 100 mM de phosphate et un tampon de lyse pH 8. Les débris cellulaires ont été séparés par centrifugation à 10000 rpm sur une centrifugeuse J2-MC (Beckman) à 4°C et le surnageant obtenu a été incubé (1 h à 4°C sous rotation constante) avec la résine Ni-NTA His-Bind prééquilibrée dans du tampon de lyse. Les billes chargées ont été lavées trois fois en utilisant un tampon de lavage Ni-NTA (300 mM de NaCl, 50 mM de tampon phosphate de sodium, 20 mM d'imidazole et pH 8,0). La protéine MAPT a été éluée en utilisant un tampon d'élution 1x Ni-NTA (300 mM de NaCl, 50 mM de tampon phosphate de sodium, 250 mM d'imidazole et pH 8,0). Les fractions éluées ont été testées pour la teneur en protéines et la taille par SDS-PAGE et coloration au bleu de Coomassie.

Pour générer un plasmide d'expression de mammifère, la réaction de clonase a été réalisée en utilisant le plasmide codant pENTR/D-TOPO MAPT conjointement avec le vecteur vide pMSCV de la même manière que décrit ci-dessus. En bref, 150 ng de pENTR/D-TOPO MAPT ont été combinés avec 150 ng de vecteur vide pMSCV dans 6 ??Tampon L TE dont 2 ??L clonase II dans un volume final de 10 ??L. La réaction de clonase a été transformée en One Shot TOP10 chimiquement compétent E. coli (Invitrogène). Les clones ont été sélectionnés sur des plaques TY/Amp et cultivés dans du milieu TY (16 h à 37°C) et le plasmide pMSCV Tau a été purifié en utilisant des colonnes Qiagen.

2.5. Génération de particules rétrovirales codant MAPT

Des rétrovirus recombinants ont été produits par transfection transitoire en utilisant des cellules HEK-293FT (Invitrogen). Des cellules HEK-293FT ont été transfectées avec le vecteur rétroviral pMSCV MAPT (3RD-MAPT3) et des plasmides codant pour GAG-POL et VSV-G en utilisant la lipofectamine 2000 (Invitrogen), selon la recommandation du fabricant.

Les cellules Rin-5F ont été utilisées pour la surexpression à médiation rétrovirale de MAPT. Des cellules Rin-5F semi-confluentes ont été transduites par voie rétrovirale par infection de spin (800 ×g, 90 min, 32°C) en présence de polybrène (7 ??g/ml). Quatre jours après la transduction, les cellules ont été traitées avec de la puromycine (1 ??g/mL) pour la chimiosélection. Le surnageant de culture a été échangé tous les trois jours et les cellules en croissance ont été repiquées tous les quatre jours.

Des cellules Rin-5F transfectantes fictives ont été obtenues en transduisant des cellules Rin-5F à l'aide d'un vecteur pMSCV vide et en chimiosélectionnant les cellules résistantes avec de la puromycine (1 ??g/ml). Cette lignée cellulaire a été utilisée à des fins comparatives et est nommée plus tard un Vide ligne cellulaire.

2.6. Tau Knockdown

Pour les expériences d'interférence ARN, les plasmides compatibles avec les lentivirus codant pour l'ARNsi ont été achetés auprès de Thermo Scientific (numéro de catalogue : RHS4533, numéros de clone : TRCN0000083973, TRCN0000083974, TRCN0000083975 et TRCN0000083976). Les quatre plasmides ont été amplifiés séparément dans E. coli et utilisé pour la génération de siRNA codant pour les particules virales. Des lentivirus recombinants ont été produits comme décrit précédemment [35].

La lignée cellulaire Rin-5F de type sauvage a été transduite avec chacun des Carte siARN comme décrit ci-dessus. Des lignées cellulaires individuelles ont été cultivées après chimiosélection avec de la puromycine (1 ??g/ml).

2.7. Immunofluorescence

Les préparations de cytospin de MAPT surexprimant et de lignées cellulaires vides ont été fixées dans de l'acétone pendant 5 min, bloquées avec du milieu RPMI 1640 contenant 10 % de FCS pendant 10 min, puis colorées avec le lapin polyclonal anti-humain Tau Ab (Cat. numéro A 0024, DakoCytomation , Danemark) (dilué 1 : 200 dans du PBS) pendant la nuit à 4°C. Après lavage dans du Tween-PBS à 0,05 % (v/v) pendant 15 min, un Ab secondaire a été appliqué, l'anti-lapin de chèvre Alexa 488 (numéro de cat. P0448, DakoCytomation) (dilué au 1 : 200 dans du PBS), et incubé pendant 2h à TA. Les lames ont été montées avec Vectashield (Vector Laboratories, Burlingame, CA, USA). Les images ont été prises à l'aide du microscope confocal Axiovert 200 M (Zeiss Jena, Allemagne) et traitées à l'aide du logiciel LSM 5 (Zeiss).

2.8. Immunobuvardage

Le Western blot a été essentiellement réalisé comme décrit dans [20]. En bref, 2 × 10 6 cellules Rn-5F (lignées cellulaires surexprimant vide et MAPT : non traitées ou traitées pendant 1 h avec soit 1 ??M ou 1 nM de Wortmannin ou avec du diméthylsulfoxyde (DMSO) comme contrôle) ont été lysés individuellement dans 100 ??L Tampon Weinberg (50 mM Hepes, pH 7,0, 0,5 % de Nonidet P-40, 250 mM de NaCl et 5 mM d'EDTA) contenant du fluorure de phénylméthylsulfonyle (10 mM), du vanadate de sodium (10 mM) et ??-glycérophosphate (1 M). Après avoir pré-clarifié le lysat cellulaire par centrifugation à 13 000 tr/min pendant 10 min, le surnageant a été combiné avec un tampon d'échantillon SDS et chargé sur 10 % de SDS-PAGE, qui a ensuite été transféré sur une membrane de transfert Immobilon-P (Millipore, Vienne, Autriche) à l'aide d'un appareil semi-sec. dispositif de buvardage. Les membranes bloquées ont été exposées o/n à 4°C à des anticorps primaires : polyclonal lapin anti-Tau humain (dilution 1 : 5000, Cat. numéro A 0024, DakoCytomation, Danemark, Glostrup), mAb anti-humain PHF-Tau, clone AT8 (dilution 1 : 2500, numéro de lot FK 93121, Pierce, Rockford, IL, USA) et anti-??-actine (dilution 1 : 5000, numéro de catalogue NB600-501, Novus Biologicals, Littleton, CO, USA). Après lavage dans du TPBS, le lapin anti-chèvre conjugué à la HRP (DakoCytomation, numéro de cat. P0048) ou la souris anti-chèvre (DakoCytomation, numéro de cat. P0047) a été appliqué et les sites de liaison des anticorps ont été visualisés par chimiluminescence qui a été enregistrée par Lumi Imageur F1 (Roche).

2.9. Dosage MTT

Des nombres égaux (2 × 10 5 ) de lignées cellulaires Rin-5F surexprimant Empty et MAPT ont été ensemencés en quatre exemplaires sur une plaque à 24 puits et incubés avec 1 ml de milieu complet pendant 36 h et 60 h. Après la période d'incubation respective, le milieu de culture a été remplacé par du RPMI contenant du MTT (bromure de 3-(4,5-diméthylthiazol-2-yl)-2,5-diphényltétrazolium) (500 ??g/ml). Après 60 min d'incubation, le milieu contenant du MTT a été retiré et le colorant formazan résultant a été dissous dans du DMSO acidifié (50 mM) contenant du SDS (10 % p/v). L'intensité de la couleur a été évaluée par mesure spectrophotométrique (

2.10. Prolifération cellulaire par évaluation du nombre de cellules

Des nombres égaux de cellules surexprimant vide et MAPT ont été étalés sur des boîtes de culture, et le nombre de cellules a été évalué par un compteur de cellules (XE-2100 Sysmex) après 60 h. L'expérience a été réalisée trois fois à des moments différents en triple.

2.11. Test de sécrétion d'insuline

(a) Des lignées cellulaires Rin-5F surexprimant vide et MAPT (2 × 10 5 cellules/puits) ont été ensemencées dans 250 ??L milieu de culture RPMI 1640 et stimulé avec 20 mM de KCl (concentration finale). Après 2 h d'incubation, le surnageant a été récolté et centrifugé à 1000 xg pendant 5 min pour sédimenter les cellules. Des cellules non stimulées ont été incluses comme contrôle. Pour mesurer la teneur en insuline intracellulaire, les cellules ont été lysées en utilisant du Tween-PBS à 1 % (v/v).

(b) Des lignées cellulaires Rin-5F surexprimant vide et MAPT (4 × 10 5 cellules/puits) ont été ensemencées sur une plaque à 12 puits. Après 24 h de culture pour obtenir l'adhérence des cellules, le surnageant de culture a été changé soit par du RPMI 1640 préchauffé uniquement, soit par du RPMI 1640 préchauffé complété avec du Wortmannin (1 ??M). Après une période d'incubation de 2 h à 37°C, un aliquot de 200 ??L a été récolté et maintenu à 4°C jusqu'à la mesure du niveau d'insuline. D'autres aliquotes (en quatre exemplaires) ont été récoltées à 4, 6, 10 et 24 h d'incubation.

Chaque expérience a été réalisée en triple à trois jours différents.

Un RIA d'insuline (dosage radio-immunologique). Un Insulin RIA (Radioimmunoassay) (numéro de cat. RI-13K, Millipore, Billerica, MA, USA) a été utilisé pour déterminer la teneur en insuline des échantillons individuels. Le dosage est basé sur l'insuline radioactive marquée au 125I et il utilise un antisérum d'insuline de rat. Le test a été effectué comme décrit dans le manuel des tests. En bref, les standards, les contrôles de qualité et les échantillons dilués avec du tampon de dosage, 1 : 10 (échantillons récoltés à 1, 2, 3 et 4 h d'incubation), 1 : 20 (à 6 h) et 1 : 50 (à 24 h), ont été incubés pendant la nuit à 4°C avec 125I-Insulin Tracer et Rat Insulin Ab. Le jour suivant, le réactif de précipitation a été ajouté. Après une période d'incubation de 20 min, le surnageant a été décanté et les tubes séchés ont été mesurés dans un compteur gamma pendant 1 min chacun.

3. Résultats

3.1. Expression MAPT dans les îlots et les insulinomes

MAPT est fortement exprimé dans le système nerveux central (SNC) où il joue un rôle crucial dans le transport axonal et la croissance des neurites [8, 36, 37]. Cependant, MAPT s'est avéré également présent dans d'autres tissus [15, 16, 38] (http://www.proteinatlas.org/) comme les parties endocrines du pancréas, du sein, de la prostate et des tubules rénaux.

Suite à nos précédentes découvertes selon lesquelles MAPT est fortement exprimé dans les îlots pancréatiques de Langerhans [20], nous avons soulevé la question de savoir si MAPT est exprimé au même niveau dans les îlots de Langerhans isolés de donneurs d'organes sains par rapport aux tumeurs à insulinome pancréatique. Pour cette raison, nous avons analysé l'ARN des îlots de donneurs d'organes sains (

) et des insulinomes ( ) pour la transcription inverse. L'ADNc obtenu a été utilisé pour vérifier la CARTE niveau d'expression des gènes. De façon intéressante, CARTE l'expression est plus de 3 fois plus élevée dans les insulinomes par rapport aux îlots, SD ± 0,12 (


Produits connexes

Il n'y a actuellement aucun avis sur ce produit.

Gagnez une carte Amazon de 30 $ ou un anticorps d'essai CUSABIO de 20 L/μg. Détails des récompenses >>

Nous avons acheté un produit d'antigène tau de souris (Mouse MAPT / Tau Protein (Recombinant 6His, N-terminus, aa2-733, CSB-YP013481MO lot #03768). Nous avons testé une expérience ELISA avec ce produit. Le test consiste en deux anticorps (Tau5 et BT2). Un signal évident a été trouvé lorsque le tau humain (2N4R) est utilisé comme antigène, mais aucun signal n'a été trouvé lorsque CSB-YP013481MO est utilisé comme antigène. Ces deux tests ont été effectués sur la même plaque et en même temps. L'épitope de Tau5 est aa504-511 (PPTREPKK) de L CSB-YP013481MO et l'épitope de BT2 est aa480-484 (RSGYS) de CSB-YP013481MO. Les deux épitopes existent dans le tau humain et le tau de souris. Nous nous demandons pourquoi l'antigène de souris CSB-YP013481MO n'a donné aucun signal sur cet ELISA, ce qui a remis en cause la certitude du produit.


Annales des progrès de la chimie

Bhaskar C Das 1,2* , Sribidya Pradhan 1 , Devi Prasana Ojha 1 , Arpita Das 1 , Narayan S Hosmane 3 et Sasmita Das 4

*Adresse pour correspondance: Bhaskar C Das, Départements de médecine et de sciences pharmacologiques, Département de chirurgie, Weill Cornell Medical College of Cornell University, Icahn School of Medicine, Mount Sinai, New York 10029, États-Unis, Courriel : [email protected]

Rendez-vous: Soumis : 22 mars 2018 Approuvé: 06 avril 2018 Publié : 09 avril 2018

Comment citer cet article : Das BC, Pradhan S, Ojha DP, Das A, Hosmane NS, et al. Le rôle de la protéine Tau dans les maladies. Ann Adv Chem. 2018 2: 001-016. DOI : 10.29328/journal.aac.1001010

Droits d'auteur: &copier 2018 Das BC, et al. Il s'agit d'un article en libre accès distribué sous la licence d'attribution Creative Commons, qui permet une utilisation, une distribution et une reproduction sans restriction sur n'importe quel support, à condition que l'œuvre originale soit correctement citée.

Résumé

Les dépôts de peptide amyloïde-β (Aβ) et de protéine tau dans le cerveau humain sont les caractéristiques pathologiques de la maladie d'Alzheimer (MA). Tau est une classe de protéines qui sont abondantes dans les cellules nerveuses et remplissent la fonction de stabilisation des microtubules. Cependant, dans certaines situations pathologiques, les protéines Tau deviennent défectueuses et ne parviennent pas à stabiliser adéquatement les microtubules, ce qui peut entraîner la génération de masses anormales toxiques pour les neurones. Ce processus se produit dans un certain nombre de troubles neurologiques connus collectivement sous le nom de tauopathies. La protéine Tau est le principal facteur des dépôts filamenteux intracellulaires liés à un certain nombre de maladies neurodégénératives, notamment la paralysie supranucléaire progressive (PSP), la maladie de Pick et le parkinsonisme. L'identification de mutations dans Tau a établi qu'un dysfonctionnement ou une mauvaise régulation de la protéine tau est suffisant pour provoquer la démence et la neurodégénérescence. Dans cet article de revue, nous avons discuté de l'étiologie de la formation de tau et du rôle dans la MA et par la suite de l'approche thérapeutique pour le désassemblage et l'inhibition de Tau.

Introduction

Le besoin d’une nouvelle approche du traitement de la maladie d’Alzheimer est urgent. La maladie d'Alzheimer est la démence liée à l'âge la plus courante et le nombre de cas aux États-Unis devrait passer du nombre actuel d'environ cinq à six millions à 15 millions d'ici 2050. Les coûts pour la vie de famille et sur la santé système de soins sont énormes. La maladie d'Alzheimer et d'autres démences devraient coûter aux États-Unis environ 226 milliards de dollars rien qu'en 2015 (estimé à 44,4 millions en 2013), ce nombre pouvant atteindre 1,1 billion de dollars en 2050 (environ 135,5 millions en 2050) [1,2 ]. La protéine Tau est le principal facteur des dépôts filamenteux liés à la MA aux côtés de divers autres troubles neurodégénératifs. La protéine Tau appartient à un groupe de protéines appelées protéines associées aux microtubules (MAP), qui en commun sont résistantes à la chaleur et limitées par le traitement acide sans perte de leur fonction [3]. Six isoformes de la protéine tau diffèrent selon le contenu des domaines de liaison à la tubuline. Ces isoformes, de taille variable, sont liées à la présence ou à l'absence de séquences codées par des exons. Parce que chacune de ces isoformes a des rôles physiologiques explicites, elles sont exprimées de manière différentielle au cours du développement du cerveau. On a dit que Tau interagissait avec un certain nombre d'autres protéines en plus de la tubuline/microtubules [4], bien que la pertinence biologique de bon nombre de ces interactions ne soit pas claire.

Tau est une protéine inhabituelle qui possède de longues étendues de régions chargées (positivement et négativement) qui ne sont pas bénéfiques pour l'association hydrophobe intermoléculaire [5]. Sur les quatre répétitions de liaison aux microtubules dans tau, les acides aminés prédits ayant une structure sont concentrés. Tau est une protéine hydrophile qui a été largement catégorisée en solution où, par analyse des spectres de dichroïsme circulaire [6], elle apparaît comme une protéine enroulée aléatoire. Avec son coefficient de sédimentation, tau a été suggéré comme une protéine très irrégulière, compatible avec la structure en bâtonnets longs observée par microscopie électronique [7]. Tau est codé par un seul gène, MAPT, qui se trouve sur le chromosome humain 17. Dans le cerveau humain, tau est exprimé sous forme de six isoformes moléculaires, qui sont le résultat de l'épissage alternatif des exons 2, 3 et 10 dans son pré-ARNm. Les six isoformes de tau diffèrent les unes des autres en ce qu'elles contiennent zéro (0N), un (1N) ou deux (2N) inserts amino-terminaux de 29 acides aminés chacun, et la présence de trois (3R) ou quatre (4R) microtubules -les répétitions de domaine de liaison dans une longueur présumée de 352 à 441 acides aminés [8-11]. Chez l'adulte, il s'agit d'une famille de quatre à six polypeptides apparentés à mol apparente. poids de 50 000 à 68 000 daltons [12].

Modifications de Tau dans la morphologie neuronale

Les neurones sont des cellules avec une morphologie très complexe les microtubules se stabilisent dans des directions spécifiques qui développent deux types d'extensions cytoplasmiques qui deviendront l'axone et les dendrites, et tau est préférentiellement localisé et actif dans les parties distales des axones où ils stabilisent les microtubules ainsi que offrant de la flexibilité. Sur la figure 1a,1b [9], l'expression de tau dans les cellules favorise la stabilisation des microtubules, conduisant à la formation d'extensions cytoplasmiques comme le montrent les flèches. La transmission neuronale se produit à travers ces processus, et tout changement dans la morphologie neuronale peut affecter le comportement et produire des événements pathologiques. Dans des situations pathologiques, il a en outre été démontré que tau était capable de former des polymères fibrillaires aberrants, comme le montrent les figures 1c et 2 (avec la permission de l'affiche du RRN 2008).

Figure 1: L'expression de tau dans les cellules non neurales (a et b) favorise la stabilisation des microtubules, conduisant à la formation d'extensions cytoplasmiques (flèches) qui ne sont normalement pas observées dans les cellules qui n'expriment pas tau. c : fibres assemblées in vitro à partir du domaine de répétition Tau pro-agrégant. (Courtoisie [9] et modifié par nos soins).

Figure 2: L'image de gauche montre une vue de la liaison de tau à un dimère de tubuline. La droite montre une description des différences entre un neurone sain par rapport à un neurone malade et le résultat d'une hyperphosphorylation tau. (Avec l'aimable autorisation du poster RRN 2008 et modifié par nos soins).

Formation de comment les protéines Tau

Les protéines Tau sont produites par épissage alternatif d'un seul gène appelé MAPT (Microtubule-Associated Protein Tau). Les protéines travaillent avec une protéine sphérique appelée tubuline pour stabiliser les microtubules et faciliter l'assemblage de la tubuline dans les microtubules. Les protéines tau contrôlent la stabilité des microtubules grâce aux isoformes et à la phosphorylation. Ces six isoformes tau sont générées par un épissage alternatif d'ARNm à partir d'un seul gène dans le cerveau humain [13,14]. Tau est une phosphoprotéine qui contient normalement 2-3 phosphates/molécule, mais elle est anormalement hyperphosphorylée avec une stoechiométrie de 9-10 moles de phosphate par mole de protéine dans le cerveau de la maladie d'Alzheimer (MA) [15,16]. À ce jour, plus de 30 sites de phosphorylation ont été identifiés dans la tau hyperphosphorylée AD, dont certains ne sont pas phosphorylés dans la tau normale. L'hyperphosphorylation (mécanismes utilisés par la cellule pour réguler la mitose) des protéines tau peut provoquer l'enchevêtrement des filaments droits, ce que l'on appelle les enchevêtrements neurofibrillaires. Ces enchevêtrements contribuent à la pathologie de la maladie d’Alzheimer. Lorsqu'un cerveau affecté par la maladie d'Alzheimer est examiné, les six isoformes de tau se trouvent souvent hyperphosphorylées en filaments hélicoïdaux appariés. Des dépôts d'agrégats anormaux enrichis en isoformes tau ont également été rapportés dans certaines autres maladies neurodégénératives. Certains aspects de la pathologie d'Alzheimer indiquent également que certaines similitudes sont partagées avec les maladies à prions.

La protéine Tau a été découverte en étudiant les facteurs nécessaires à la formation des microtubules. La protéine Tau favorise l'assemblage de la tubuline en microtubules, l'un des composants majeurs du cytosquelette neuronal qui définit la morphologie normale et fournit un support structurel aux neurones [17,18]. La liaison à la tubuline de tau est régulée par son état de phosphorylation, qui est normalement régulé par l'action coordonnée des kinases et des phosphatases sur la molécule tau [19,20].

Les tauopathies sont considérées comme un groupe de troubles qui sont la conséquence d'une phosphorylation anormale de tau, de niveaux anormaux de tau, d'un épissage anormal de tau ou de mutations du gène tau. Dans certaines tauopathies, comme la maladie d'Alzheimer ou le syndrome de Down, la pathologie tau est associée à d'autres changements cérébraux. La majorité des maladies neurodégénératives sont caractérisées par le dépôt de protéines insolubles dans les cellules du système neuromusculaire. Les progrès de la neuropathologie moléculaire ont permis un système de classification des maladies neurodégénératives basé sur cette accumulation de protéines. La tau associée aux microtubules est une protéine qui a des fonctions importantes dans les neurones sains, mais forme des dépôts insolubles dans les maladies comme les tauopathies. Les tauopathies englobent plus de 20 entités clinicopathologiques, dont la maladie d'Alzheimer, la tauopathie la plus fréquente. Il existe d'importantes similitudes cliniques, pathologiques, biochimiques et génétiques dans la gamme de ces maladies et elles ont contribué à faire progresser notre compréhension des facteurs qui initient la neurodégénérescence et l'accumulation de tau.

La maladie d'Alzheimer est la tauopathie la plus fréquente et la mieux étudiée dans laquelle deux principales structures pathologiques se forment dans le cerveau des patients : les plaques séniles (composées du peptide β-amyloïde), et les enchevêtrements neurofibrillaires (NFT), Elle génère des problèmes de mémoire récente. , une fonction associée au lobe temporal, et dans les dysfonctionnements visuels et spatiaux et la mauvaise exécution des tâches sur-appris, fonctions du lobe pariétal. En lien avec la tendance mondiale à prolonger la vie humaine et le nombre croissant de personnes âgées dans la population, la maladie d'Alzheimer devient l'un des problèmes de santé et socio-économiques les plus graves du moment. La protéine Tau favorise l'assemblage et stabilise les microtubules comme mentionné précédemment, ce qui contribue au bon fonctionnement du neurone. Des modifications de la quantité ou de la structure de la protéine tau peuvent affecter son rôle de stabilisateur des microtubules ainsi que certains des processus dans lesquels elle est impliquée. La phosphorylation et la troncature anormales de la protéine tau ont attiré l'attention en tant que mécanismes clés qui deviennent la protéine tau dans une unité pathologique. Des preuves de la signification pathologique clinique de tau phosphorylée et tronquée ont été documentées au cours de la progression de la MA ainsi que leur capacité à utiliser la cytotoxicité lorsqu'elle est exprimée dans des modèles cellulaires et animaux. La maladie d'Alzheimer est le type de démence le plus courant caractérisé par des troubles de la mémoire et une altération de diverses capacités cognitives. La maladie d'Alzheimer et les tauopathies associées sont classées histopathologiquement par neurodégénérescence lente et progressive, qui est principalement associée à une accumulation intracellulaire de protéine tau conduisant aux enchevêtrements neurofibrillaires (NFT) et à d'autres inclusions contenant du tau modifié (Figure 3) [21,22]. Dans des conditions pathologiques, comme dans le cas de la MA, non seulement une phosphorylation anormale de la protéine tau diminue sa capacité de liaison à la tubuline conduisant à une désorganisation des microtubules, mais cette protéine s'auto-polymérise et s'agrège sous forme de NFT [21,22].

Figure 3: Avec l'aimable autorisation [21] et modifié par nos soins) Histopathologie du cerveau humain [21,22]. A et B) maladie d'Alzheimer, C) démence de Pick, C) dégénérescence corticobasale D) paralysie supranucléaire progressive.

Dans la MA, le rôle normal de la protéine tau est inefficace pour maintenir le cytosquelette bien organisé dans le processus axonal car la protéine perd sa capacité à se lier aux microtubules. Ce comportement anormal est confirmé par des changements de conformation et mis-repliement dans la structure normale du tau [23-25] qui conduit à son agrégation aberrante en structures fibrillaires à l'intérieur des neurones des individus déments [26-28]. Ainsi, la plupart des pools modifiés de protéine tau dans la maladie sont redistribués et agrégés à la fois dans le compartiment et dans les processus isolés des neurones affectés. Des altérations de la quantité ou de la structure de la protéine tau peuvent affecter la stabilisation des microtubules et d'autres processus liés à cette protéine [29,30]. De plus, la protéine tau phosphorylée est attirée par la kinésine et est donc transportée vers les sites distaux du neuropile. Cela peut expliquer l'observation selon laquelle la pathologie de l'enchevêtrement dans la maladie d'Alzheimer semble s'initier de manière distale, puis se propage de manière inverse au péricaryon. Ce processus peut être un mécanisme pour protéger la stabilité des microtubules en transportant plus rapidement la tau hyperphosphorylée vers d'autres emplacements cellulaires où la tau peut former des agrégats [31].

Les autres maladies associées à la tauopathie sont la dégénérescence corticobasale, la maladie de Picks, la paralysie supranucléaire progressive et le syndrome de Down. La dégénérescence corticobasale est un trouble caractérisé par des troubles cognitifs tels que l'aphasie et l'apraxie, une démence modérée et des troubles moteurs tels que l'inflexibilité, la dystonie des membres et les tremblements. Les analyses pathologiques ont indiqué des inclusions gliales et neuronales de tau. Tau est également présent sous forme hyperphosphorylée, mais seules certaines formes de poids moléculaire peuvent être détectées par électrophorèse. La maladie de Pick est une démence qui produit des troubles du langage et du comportement et est associée à une atrophie du lobe frontal. Elle provoque des changements dans le caractère du patient et dans ses interactions avec les autres, ainsi que la dépression. Ce trouble est caractérisé par la présence d'inclusions cytoplasmiques de tau dans les neurones du lobe frontal, appelées corps de Pick. Les cellules granuleuses du gyrus denté sont également affectées. Il y a une absence d'expression de l'exon 10 [32], composante très vitale, suggérant que la dégénérescence des populations neuronales sélectives dans différentes tauopathies reète le schéma physiologique des isoformes tau exprimées. La paralysie supranucléaire progressive (PSP), également connue sous le nom de trouble de Steele, Richardson et Olszewski, se caractérise par une paralysie supranucléaire du regard ainsi que par une instabilité posturale importante et, dans les derniers stades, par une démence. Des inclusions de Tau ont été trouvées dans les cellules neuronales et gliales, les astrocytes et les oligodendrocytes (corps enroulés) étant affectés [33]. Le syndrome de Down est dû à la trisomie du chromosome 21 qui entraîne un défaut de croissance et de maturation du cerveau, produisant une déficience cognitive et une démence. Dans ce trouble, le tau est également hyperphosphorylé, ce qui donne un schéma similaire à celui de la maladie d'Alzheimer. D'autres tauopathies impliquant le tau hyperphosphorylé comprennent le parkinsonisme avec démence, la dystrophie myotonique et les maladies à prions avec enchevêtrements.

Options de traitement pour les tauopathies

À l'heure actuelle, il n'existe aucune option de traitement pharmacologique approuvée et établie pour les tauopathies. Les stratégies de traitement disponibles sont principalement basées sur de petits essais cliniques, divers rapports de cas ou de petites études. Des agents thérapeutiques approuvés pour la démence d'Alzheimer, tels que les inhibiteurs de l'acétylcholinestérase et la mémantine, ont été utilisés hors AMM pour traiter les symptômes cognitifs et comportementaux des tauopathies, mais les résultats n'ont pas été cohérents. Pour le comportement ou les symptômes, un traitement avec des antidépresseurs, en particulier des inhibiteurs sélectifs de la recapture de la sérotonine, pourrait être utile. En plus des options de traitement pharmacologique, une thérapie physique ou orthophonique peut être appliquée pour améliorer les capacités fonctionnelles. Chaque intervention pharmacologique doit être adaptée aux symptômes spécifiques de chaque patient, et les décisions concernant le type et la durée du traitement doivent être basées sur son efficacité pour l'individu et la tolérance du patient. Actuellement, aucun traitement efficace n'est disponible qui cible la cause de ces maladies. Dans l'ensemble, seul un traitement symptomatique est disponible pour la MA et les maladies du mauvais repliement de la protéine tau, et les nouveaux concepts thérapeutiques vont des vaccinations tau et des stratégies d'antiphosphorylation aux médicaments stabilisant les microtubules et anti-agrégation.

Déficiences basées sur les médicaments anti-inflammatoires ou antioxydants

Sur la base d'observations cliniques, les individus traités par des études épidémiologiques étaient maintenus de manière chronique sous anti-inflammatoires ou antioxydants pertinents pour d'autres pathologies présentant un risque plus faible de développer des troubles cognitifs et la MA [34]. L'hypothèse a été approuvée par diverses autres études qui montre la diminution des NFT [35,36], la phosphorylation tau [37], les déficits neurocomportementaux (mémoire) [38], la charge Aβ42 [39,40], la dégénérescence synaptique [41-43] , et le dysfonctionnement mitochondrial [44]. Divers antioxydants et agents anti-inflammatoires qui ont fourni une neuroprotection pour la MA sont la curcumine [40], l'acide alpha-lipoïque [45-47], la vitamine E [48,49], le resvératrol [50], les phytonutriments [51], la cyclooxygénase 2 inhibiteurs [52], le Ginkgo [53] et la mélatonine [54].

Des études ont montré que le rôle majeur d'une hyperphosphorylation tau qui conduit à la déformation des protéines tau, peut être attribué à (i) une perturbation centrale de la signalisation de l'insuline par le récepteur de l'insuline ou (ii) des délétions du gène du substrat du récepteur de l'insuline (IRS) 2, (iii ) après injections intracérébrales de streptozotocine (Figure 4) [55]. Par conséquent, un supplément d'insuline pourrait améliorer la cognition et le métabolisme énergétique cérébral chez les personnes atteintes de troubles cognitifs légers ou de MA précoce. De plus, des études ont montré que l'administration d'insuline améliore la clairance de l'Aβ-42, diminue l'activité des kinases qui favorisent l'hyperphosphorylation de la protéine tau et améliore la signalisation par les voies nécessaires à la plasticité synaptique [55-58].

Figure 4 : Pertinence de la voie tau et de l'insuline. [55-58] (Avec l'aimable autorisation de [55] et modifié par nos soins).

a) Anti-phosphorylation de Tau

Dans un autre mécanisme, l'inhibition de l'hyperphosphorylation pourrait produire une condition évitable pour la formation des enchevêtrements neurofibrillaires. Des études ont montré que la protéine glycogène synthase kinase-3 (GSK-3) a une fonction importante dans la stimulation de l'hyperphosphorylation des protéines tau. W. Noble et K. Duff ont présenté [59] un in vivo étude avec des souris transgéniques surexprimant la tau humaine mutante. Les souris ont été traitées avec le chlorure de lithium inhibiteur de la glycogène synthase kinase-3 (GSK-3). Le traitement a entraîné une inhibition significative de l'activité de la GSK-3.L'administration de lithium a également entraîné des niveaux significativement plus bas de phosphorylation au niveau de plusieurs épitopes de tau connus pour être hyper phosphorylés dans la maladie d'Alzheimer et des niveaux significativement réduits de tau agrégé et insoluble. L'étude a également révélé que les souris traitées au chlorure de lithium présentaient moins de dégénérescence si l'administration était commencée pendant les premiers stades du développement de l'enchevêtrement. Ces résultats soutiennent l'idée que les kinases sont impliquées dans la progression de la tauopathie et que les inhibiteurs de kinases peuvent être efficaces thérapeutiquement [59]. Les thérapies potentielles impliquent principalement des protéines tau déformées. Ces cibles thérapeutiques comprennent l'inhibition de l'hyperphosphorylation de la protéine tau, la stabilisation des microtubules, la prévention de l'oligomérisation de la protéine tau et l'amélioration de la dégradation de la protéine tau ainsi que l'immunothérapie de la protéine tau. En l'absence de cure à ce jour, l'important est que les quelques médicaments sont en cours d'essais précliniques. L'un de ces médicaments prometteurs est le LMTX (Schéma 1), qui est actuellement dans la troisième phase des essais cliniques [60]. Le LMTX dérivé du chlorure de méthylthionium agit généralement comme un inhibiteur de l'hyperphosphorylation de la protéine tau.

Schéma 1 : Structure chimique du médicament LTMX.

b) Déphosphorylation de Tau

Le mécanisme de neutralisation contre les phosphorylations anti tau serait le processus de déphosphorylation, qui peut régénérer les protéines tau à partir des filaments hélicoïdaux appariés (PHF) toxiques et agrégés. Dans un processus pour guérir les protéines hyperphosphorylées, Gong et al ont étudié la cinétique de la déphosphorylation de Tau catalysée par PP5. PP5 est une phosphoséryl/phosphothréonyl protéine phosphatase avec un caractère efficace de déphosphorylation de tau étudiée précédemment par les mêmes groupes [63]. Fait intéressant, PP5 déphosphoryle tau au moins sur 12 sites de phosphorylation avec des efficacités différentes. De plus, PP5 peut déphosphoryler le tau dans les cellules vivantes avec le cerveau AD. Dans l'ensemble, les études sont en cours pour fournir une déphosphorylation qui pourrait être une stratégie possible pour guérir les cerveaux affectés par la MA [64]. Sur la base de quelques rapports, les agonistes et les antagonistes de 5HT6 ont un impact crucial sur l'amélioration de la mémoire et de l'apprentissage chez les humains ainsi que les animaux. Il est également évident que l'activité cholinergique se détériore progressivement, en raison de la dégénérescence des neurones cholinergiques. Par conséquent, les composés affectant les récepteurs 5-HT6 représentent des cibles thérapeutiques potentielles pour le traitement symptomatique de la MA. Dans ce contexte, l'Idalopirdine (Lu AE58054) agit comme un antagoniste sélectif des récepteurs 5HT6 et a fait l'objet d'essais cliniques de phase II considérables avec peu d'effets secondaires. De plus, le médicament est en essai de phase III [65-68]. Dans un mécanisme de fonction similaire, le médicament SB742457 (Schéma 3) pourrait produire des résultats efficaces par rapport à l'idalopirdine [69].

Schéma 2 : Médicament anti-phosphorylation Tau Tideglusib.

Schéma 3 : Structure chimique des antagonistes des récepteurs 5HT6.

Semblables aux récepteurs de la sérotonine, les récepteurs présynaptiques de l'histamine H3 se trouvent également de manière uniforme dans le cortex préfrontal, l'hippocampe et l'hypothalamus. Par conséquent, sont également responsables des aspects de mémoire et de reconnaissance pour le cerveau humain. L'utilisation d'antagonistes H3 devrait améliorer la neurotransmission cholinergique en raison de la libération d'acétylcholine, de dopamine et de GABA dans la fente synaptique. Par conséquent, en travaillant sur cette hypothèse, deux médicaments ont été introduits, tels que l'ABT-288 et le GSK239512 (schéma 4). Les essais cliniques de phase I et de phase II du premier ont montré une énorme activité anti-MA tandis que le dernier médicament n'a montré aucun progrès considérable chez les patients atteints de MA faible à modérée [70-73].

Schéma 4: Structure chimique des antagonistes des récepteurs de l'histamine H3.

Azeliragon (TTP488) est un inhibiteur oral à petites molécules du récepteur du produit final de glycation avancée (RAGE), qui médie le transport du peptide Aβ des compartiments périphériques aux compartiments du SNC dans le cerveau [74]. Ce médicament fait actuellement l'objet d'essais de phase III chez des patients atteints de MA légère à modérée (NCT02080364). L'encénicline a été introduite dans des essais de phase III avec des résultats positifs en phase II. Le médicament est un agoniste sélectif du 7-nAChR (récepteur nicotinique de l'acétylcholine a-7). De même, la nilvadipine est un antagoniste du calcium dihydropyridine actuellement approuvé pour le traitement de l'hypertension (Nivadil) (Schéma 5). Les observations cliniques ont révélé son influence positive sur la cognition chez les patients traités [75,76].

Schéma 5 : Structure des médicaments anti-Alzheimer dans les essais cliniques de phase III représentant différents mécanismes d'action.

c) Chélateurs de métaux : une chimiothérapie possible pour la maladie d'Alzheimer

Répartition du cuivre, du fer et du zinc en tant que composants clés liés au métabolisme amyloïde. Par conséquent, les dysfonctionnements de ces ions métalliques sont responsables des dépôts d'amyloïdes et d'autres protéines mal repliées entraînant les diverses maladies neurodégénératives. La restauration de l'homéostasie de ces ions métalliques sous quelque forme que ce soit peut éventuellement être une chimiothérapie essentielle. L'addition externe de quelques chélateurs a trouvé une activité améliorée pour les ions métalliques. Ceux-ci stimulent par une faible coordination avec l'ion métallique et se lient en outre aux dépôts de protéines ou d'oligomères. Dans un tel cas, le potentiel de PcTS (Schéma 6) en tant que modulateur amyloïde a été exploré sur la protéine tau et le peptide bêta-amyloïde (Aβ), considérés comme les composants pathologiques de la maladie d'Alzheimer. PcTS a pu interférer avec l'assemblage du filament tau in vitro en induisant la conversion de l'état de protéine non toxique en oligomères solubles caractérisés par l'absence d'éléments structuraux en hélice ou en feuillet dans son architecture moléculaire [77].

Schéma 6 : Structure chimique de PcTS en tant que modulateur amyloïde.

L'hypothèse de la cascade amyloïde postule que le dépôt d'Aβ est un événement initial dans la pathogenèse et que le dépôt d'Aβ peut précéder les symptômes de la MA chez certains patients d'au moins 20 ans. La thérapie amyloïde-β avec des immunisations actives et passives contre Aβ a une forte possibilité d'être efficace pour éliminer Aβ du cerveau et pourrait empêcher la pathologie en aval. Depuis 2000, un certain nombre d'essais cliniques pour l'immunothérapie de la MA ont commencé, ont échoué et se poursuivent. Asuni et ses collègues ont étudié une vaccination de souris transgéniques P301L, avec des enchevêtrements neurofibrillaires développés dans plusieurs régions du cerveau et de la moelle épinière, avec un peptide de fragment tau. La vaccination a réduit le tau agrégé dans le cerveau et a ralenti la progression du phénotype comportemental lié à l'enchevêtrement par rapport aux animaux témoins [78].

e) Stabilisation des microtubules par la thérapeutique

Le tau normal a un rôle clé dans la stabilisation des microtubules et le maintien des réseaux MT essentiels au transport axonal dans les neurones. L'échec de ces actions par le tau hyper phosphorylé entraîne l'instabilité des microtubules et se caractérise par des inclusions de tau. Trojanowski JQ et al., ont étudié une liaison aux microtubules par des médicaments externes qui pourraient faciliter la séquestration de tau en stabilisant les microtubules et en inversant les déficits de transport axonal rapide dans un modèle de tauopathie. La découverte a utilisé du paclitaxel ou du Taxol (médicament anticancéreux bien connu) injecté à des souris transgéniques pendant une période de 12 semaines. L'étude a montré que les résultats étaient intéressants car à la fois les microtubules stables étaient augmentés et le transport axonal rapide restauré dans les axones rachidiens [79]. Dans un autre cas, la stabilisation des microtubules par liaison à la tubuline avait été abordée avec un médicament à petite molécule, l'épothilone D (BMS-241027) et le TPI-287 (Schéma 7) [80].

Schéma 7 : Structure chimique du paclitaxel ou du taxol.

Au cours des dernières années, l'espoir a été soulevé que la thérapie de remplacement cellulaire permettrait de guérir en compensant les systèmes neuronaux perdus. Les cellules souches obtenues à partir de tissus embryonnaires et adultes et greffées dans le cerveau intact de souris ou de rats ont été principalement suivies de leur incorporation dans le parenchyme de l'hôte et de leur différenciation en lignées neurales fonctionnelles. Dans le cerveau lésé, les cellules souches présentaient une migration ciblée vers les régions endommagées du cerveau, où elles se greffaient, se multipliaient et mûrissaient en neurones fonctionnels. Les observations dans des modèles animaux de MA ont fourni des preuves que les cellules souches ou les cellules précurseurs neurales (NPC) transplantées survivent, migrent et se différencient en neurones cholinergiques, astrocytes et oligodendrocytes avec une amélioration des déficits d'apprentissage/mémoire. Outre le remplacement des cellules perdues ou endommagées, les cellules souches stimulent les précurseurs neuronaux endogènes, améliorent la neuroplasticité structurelle et régulent à la baisse les cytokines pro-inflammatoires et la mort apoptotique neuronale. Les cellules souches pourraient également être génétiquement modifiées pour exprimer des facteurs de croissance dans le cerveau. Au cours des dernières années, des preuves ont indiqué que le cerveau adulte des mammifères préserve la capacité de générer de nouveaux neurones à partir de cellules souches neurales. Fait intéressant, de nombreux médicaments, y compris les antidépresseurs, le lithium, l'acétylcholinestérase et les inhibiteurs, ont pu améliorer la neurogenèse altérée dans ce processus pathologique. Cela a ouvert la voie à l'exploration d'une éventuelle manipulation pharmacologique de la neurogenèse qui offrirait une approche alternative pour le traitement de la MA [81-87].

g) Acides gras essentiels et Tau dans les maladies neurodégénératives

Les acides gras polyinsaturés (AGPI) sont nécessaires au maintien de la structure, de la fonction et de l'intégrité vasculaire du cerveau. Le cerveau peut synthétiser des acides gras non essentiels, mais les AGPI essentiels (par exemple, l'acide arachidonique [AA] et l'acide docosahexaénoïque [DHA]) sont en grande partie acquis à partir de la circulation périphérique [88]. Le métabolisme de l'acide arachidonique produit des métabolites lipidiques pro-inflammatoires, tels que les prostaglandines et les leucotriènes, tandis que le métabolisme du DHA génère des médiateurs anti-inflammatoires, tels que les résolvines. Par conséquent, une augmentation des rapports AA/DHA pourrait favoriser l'inflammation, contribuant davantage à la pathogenèse de la MA [89]. L'acide docosahexaénoïque (DHA, 3 22:6, n-3) est un AGPI à longue chaîne n-3 qui a récemment attiré l'attention en raison de ses divers effets bénéfiques sur la santé humaine. Le DHA est essentiel pour le développement du cerveau, et le DHA ou ses précurseurs, tels que l'acide -linolénique (18:3, n-3) doivent être obtenus à partir de l'alimentation ou de l'apport maternel pendant la grossesse car l'acide α-linolénique ne peut pas être synthétisé de novo par les tissus animaux. L'accumulation de DHA dans le tissu neural est considérablement augmentée pendant la période périnatale, lorsque le lobe frontal et l'hippocampe subissent une croissance intensive et que la neurogenèse, la neuritogenèse et la synaptogenèse se produisent activement. Par conséquent, un approvisionnement adéquat en DHA est nécessaire au bon développement du cerveau [90].

h) Le rôle de l'acide rétinoïque (AR) dans la modulation Tau

Il a été démontré que l'acide rétinoïque, un facteur essentiel dérivé de la vitamine A, a diverses fonctions, notamment des rôles d'antioxydant et de différenciation cellulaire. Étant donné que le stress oxydatif et la dédifférenciation des neurones semblent être des éléments pathologiques courants d'un certain nombre de troubles neurodégénératifs, la PR peut offrir une promesse thérapeutique. La PR peut avoir des propriétés thérapeutiques idéales pour le traitement de la MA. La surveillance du dosage et de la sécurité sera un défi majeur sur lequel se concentrer principalement. On s'attend à ce qu'une série d'essais cliniques survienne dans un proche avenir, qui seront conçus pour mieux comprendre l'efficacité des mécanismes de la PR. Très récemment, Das et son groupe ont publié des articles de revue expliquant le rôle des rétinoïdes naturels et synthétiques dans la MA [91,92].

Les facteurs étiologiques, autres que l'âge avancé et la susceptibilité génétique, restent à déterminer. De plus en plus de preuves soulignent les rôles de risque potentiels des facteurs de risque et des troubles vasculaires tels que le tabagisme, l'hypertension artérielle et l'obésité à mi-vie, le diabète et les lésions cérébrovasculaires et les rôles bénéfiques possibles des facteurs psychosociaux tels que l'enseignement supérieur, l'engagement social, l'exercice physique, et des activités de stimulation mentale, dans le processus pathogénique et la manifestation clinique des troubles démentiels. Les interventions sur les facteurs de risque vasculaire et le maintien de modes de vie socialement intégrés et d'activités mentalement stimulantes devraient réduire le risque d'apparition clinique de démence, y compris la MA.

Sommaire

Tau est une protéine associée aux microtubules qui stabilise les microtubules neuronaux dans des conditions physiologiques normales en raison de la redondance fonctionnelle et de la présence d'autres protéines associées aux microtubules. Cependant, dans des situations pathologiques, tau peut être hyperphosphorylé et assemblé de manière aberrante. Conséquence de ces modifications, la toxicité neuronale se complète, entraînant l'apparition de troubles neurologiques, principalement des démences par exemple la maladie d'Alzheimer, qui sont collectivement appelées tauopathies. Différents types de neurones sont endommagés dans différentes tauopathies, et l'esquisse des mécanismes à la base de cette spécificité sera probablement la neurodégénérescence objective.

Il est largement admis que l'apparition clinique de la démence dans la maladie d'Alzheimer est due à la perte neuronale se produisant dans les zones du cerveau associées aux fonctions cognitives des patients. Les présences fibrillaires seraient responsables de la mort cellulaire. Cependant, des incohérences ont émergé des études démontrant que la déficience cognitive dans les modèles animaux se produit plus tôt que la formation initiale des structures fibrillaires. Dans cette préoccupation, de nombreux rapports analysant le cerveau de patients atteints de la maladie d'Alzheimer s'accordent sur le fait que l'agrégation fibrillaire de tau est le meilleur corrélateur avec l'apparition et la progression de la démence. Il est généralement admis que les modifications post-traductionnelles anormales, c'est-à-dire l'hyperphosphorylation, l'acétylation, la glycation, la nitration, la troncature et autres, sont responsables de l'altération de la structure tau dans la maladie d'Alzheimer. De plus, une détermination précise de la protéine tau altérée dans le liquide céphalo-rachidien et d'autres fluides corporels peut fournir de meilleures attentes pour prédire l'apparition et l'évolution de la démence.


Matériaux et méthodes

Protéines kinases et leurs inhibiteurs

His-BRSK1, His-BRSK2, His-MARK1, His-SIK et His-MELK ont été achetés auprès de Millipore (Dundee, Royaume-Uni). His-BRSK1 et His-MARK1 activés ont été dosés par phosphorylation de CHKtide (KKKVSRSGLYRSPSMPENL NRPR). Une unité d'activité était la quantité d'enzyme qui incorporait 1 nmol de phosphate dans CHKtide par minute. His-BRSK2 et MELK activés ont été dosés par phosphorylation de ZIPtide (KKLNRTLSFAEPG). Une unité d'activité était la quantité d'enzyme qui incorporait 1 nmol de phosphate dans ZIPtide par minute. His-SIK activé a été dosé par phosphorylation du peptide AMARA (AMARAASAAALARRR). Une unité d'activité était la quantité d'enzyme qui incorporait 1 nmol de phosphate dans le peptide AMARA par minute. Les inhibiteurs de protéine kinase BX 795 et SU 6656 ont été achetés chez Axon Medchem (Groningue, Pays-Bas) et Calbiochem (San Diego, CA, USA), respectivement.

Anticorps

Les anticorps anti-tau monoclonaux dépendant de la phosphorylation AT8 et AT100 ont été achetés auprès d'Innogenetics (Gand, Belgique). Anticorps anti-tau dépendant de la phosphorylation polyclonale phospho-S199 (pS199), phospho-T212 (pT212), phospho-S214 (pS214), phospho-T217 (pT217), phospho-S262 (pS262), phospho-S356 (pS356) et phospho-S396 (pS396) ont été achetés auprès de BioSource International (Camarillo, CA, USA). L'anticorps polyclonal indépendant de la phosphorylation BR134 a été utilisé pour sonder la tau totale (Goedert et al. 1989a,b). Un anticorps monoclonal anti-LKB1 et un anticorps polyclonal anti-BRSK1 ont été achetés auprès d'Abcam (Cambridge, Royaume-Uni). Un anticorps polyclonal anti-BRSK2 a été acheté auprès de Proteintech Group Inc. (Manchester, Royaume-Uni). Un anticorps polyclonal anti-MARK1 a été acheté auprès de Cell Signaling (Danvers, MA, USA). Un anticorps polyclonal anti-SIK humain a été acheté auprès de Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Un anticorps monoclonal anti-α-tubuline a été acheté chez Invitrogen (Eugene, Oregon, USA). L'anticorps monoclonal 12E8, qui reconnaît la protéine tau phosphorylée en S262/S356, était un don du Dr P. Seubert (Elan Pharmaceutials) ( Seubert et al. 1995). Les anticorps anti-IgG de souris et anti-IgG de lapin conjugués à la peroxydase de raifort ont été achetés auprès de Bio-Rad (Hercules, CA, USA).

Plasmides

L'ADNc codant pour le SIK humain a été amplifié par amplification en chaîne par polymérase (PCR) à partir d'une banque d'ADNc de cerveau humain et sous-cloné dans le vecteur d'expression eucaryote pExchange3B avec une étiquette FLAG à l'extrémité N-terminale (Stratagene, La Jolla, CA, USA). L'ADNc codant pour l'isoforme de 412 acides aminés du tau du cerveau humain a été sous-cloné dans le vecteur d'expression eucaryote pSG5 (Stratagene, La Jolla, CA, USA) ou le vecteur d'expression bactérien pRK172 (Goedert et Jakes 1990). La mutagenèse dirigée a été réalisée comme décrit précédemment ( Yoshida et Goedert 2006 ), pour générer des mutants SIK inactifs pour la kinase (D167A et T182A) et les mutants tau suivants (en utilisant la nomenclature de l'isoforme de 441 acides aminés) : S262A, S356A, S262A /S356A, S262A/S293A/S356A, S262A/S324A/S356A, S262A/S305A/S356A, S262A/S293A/S305A/S324A/S356A, S214A/S262A/S293A/S305A/S2356A/S3214A/S/S29A3356A/S3214A/S /S305A/S324A/S356A. Toutes les constructions ont été vérifiées par séquençage d'ADN.

Essais de phosphorylation

Ils ont été effectués à 30°C dans 25 L de tampon de dosage [25 mM Tris-HCl (pH 7,4), 0,1 mM d'EGTA, 2 mM de 4-(2-aminoéthyl) benzènesulfonyl fluorure hydrochloride (AEBSF), 2 μM de protéine tau recombinante, 10 mM acétate de magnésium, 2 mM [γ- 32 P] ATP (environ 10 6 cpm/nmol)] et 1 U/mL BRSK1, BRSK2, MARK1, SIK ou MELK, comme décrit ( Yoshida et al. 2004 Yoshida et Goedert 2006). Les tests de phosphorylation utilisant CHKtide ont été effectués conformément aux instructions du fabricant. En bref, 100 M de peptide ont été incubés pendant 10 min à 30°C dans 25 L de tampon de dosage et 1 U/mL de kinase en présence ou en l'absence d'inhibiteur. La réaction a été interrompue par addition de 5 L d'acide phosphorique à 3 %. La quantité de radioactivité 32P incorporée a été déterminée par analyse par imagerie au phosphore ou par comptage à scintillation liquide, comme décrit ( Yoshida et Goedert 2006 Virdee et al. 2007 ).

Culture de cellules

Des cellules 293T de rein embryonnaire humain (HEK) ou des cellules SHSY5Y de neuroblastome humain ont été maintenues dans du milieu Eagle modifié (DMEM) de Dulbecco, additionné de 10 % de sérum bovin fœtal et de pénicilline/streptomycine à 37 °C dans un mélange de 5 % de CO2 atmosphère. Ils ont été cultivés à 50 % de confluence sur des plaques à 6 puits (Corning, Amsterdam, Pays-Bas). Les cellules HEK293T ont été transfectées avec 0,5 µg d'ADN plasmidique en utilisant 2 µL de réactif FuGENE 6 ® (Roche, Mannheim, Allemagne) par puits, selon les instructions du fabricant. Les cellules ont été utilisées 48h après transfection.

Des neurones corticaux primaires ont été préparés à partir du cortex cérébral embryonnaire du rat Sprague-Dawley au jour 18 par dissociation avec de la trypsine et étalés sur des plaques à 6 puits recouvertes de poly-l-lysine à une densité de 1 × 10 5 cellules/puits. Les cellules ont été étalées dans un milieu essentiel minimal contenant des sels d'Earle et de la glutamine avec 10 % de sérum de cheval, 0,45 % de glucose, 1 mM de pyruvate, 25 M de glutamate et de la pénicilline/streptomycine. Après 3 h, le milieu a été remplacé par du milieu neurobasal avec un supplément de B27, 0,5 mM de glutamine et de la pénicilline/streptomycine. Les cellules ont été utilisées après 8 jours de culture.Tous les milieux et suppléments pour la culture provenaient d'Invitrogen (Eugene, Oregon, USA). Dans des expériences avec des inhibiteurs de protéine kinase, du BX 795 ou du SU 6656 a été ajouté aux cellules (concentration finale de 1 M) pendant 30 min.

Régulation à la baisse de MARK1 et SIK

Des cellules de neuroblastome humain SHSY5Y ont été maintenues dans du milieu DMEM supplémenté avec 10 % de sérum bovin foetal. Les cellules ont été transfectées de manière stable avec des constructions shRNA HuSH 29mer contre MARK1 (MARK1-1 : CGGACGCCATTGCCGACGGTGAACGAGCG MARK1-2 : AGCCTTACGGAGATGTCTGTGAGTAGCAT), SIK (SIK-1 : CTTGAGCGGCTCAAGGAGTATCGGAA-TGC SIK-2 négatives : GACAGTCTGAGRNAC GACAGTCTGAGRNAC300) -Vecteur RS-V-RS (Origene, Rockville, MD, USA) utilisant la Lipofectamine™ (Invitrogen) selon les instructions du fabricant. Les cellules ont été sélectionnées sous 2 g/mL de puromycine (Invitrogen) pour générer des lignées stables regroupées. Les cellules positives expriment la GFP en plus des shRNA 29 mer contre MARK1, SIK et contrôle shRNA. L'efficacité de la transfection a été contrôlée par comptage cellulaire et immunoblot avec des anticorps anti-MARK1 et anti-SIK. Les cellules résistantes à la puromycine ont été réparties sur des boîtes de 10 cm et cultivées pendant 7 jours. Après deux lavages avec une solution saline tamponnée au phosphate (PBS), les cellules ont été lysées dans 250 L de tampon d'échantillon de dodécylsulfate de sodium et immunoblottées. Dans certaines expériences, les cellules ont été cultivées sur des lamelles de verre (13 mm de diamètre, épaisseur n°1, VWR International) pendant une semaine, lavées et fixées avec du paraformaldéhyde à 3% (Electron Microscopy Sciences, Hatfield, PA, USA) dans un environnement sans sérum. moyen (DMEM) pendant 10 min. Après deux lavages avec du PBS, les lamelles ont été placées sur des lames de verre. Les cellules ont été immunocolorées avec 12E8 et suivies d'un sondage avec un anticorps IgG anti-souris conjugué à Alexa555 (Invitrogen) et DAPI (invitrogen) pour une coloration nucléaire. Les cellules ont été visualisées avec un microscope à fluorescence Leica DMRB et les images traitées à l'aide d'un système Leica AF4000 (Wetzlar, Allemagne).

Préparation des tissus

Des rats d'un jour et de 6 mois ont été tués par dislocation cervicale. Leurs cerveaux ont été homogénéisés dans 4 volumes de TBS [50 mM Tris-HCl (pH 7,4), 150 mM de chlorure de sodium, 1 mM d'EDTA, 50 mM de fluorure de sodium, 10 mM de β-glycérophosphate, 0,5 mM d'orthovanadate de sodium, 5 mM de pyrophosphate de sodium et cocktail complet d'inhibiteur de protéase (Roche)] et centrifugé à 543 000 g pendant 20 min à 4°C. Le surnageant résultant a servi de fraction soluble. La fraction insoluble dans le sarkosyl (A68) a servi de témoin positif. Il a été préparé à partir du cerveau de souris transgéniques âgées de 6 mois exprimant la protéine tau P301S humaine, comme décrit précédemment (Allen et al. 2002 Yoshida et Goedert 2006 ). Le culot résultant a été utilisé comme fraction insoluble dans le sarkosyl. Les concentrations de protéines ont été déterminées en utilisant le kit de dosage de protéines BCA (Pierce, Rockford, IL, USA).

Immunobuvardage

L'immunotransfert de tau recombinant a été réalisée comme décrit ( Yoshida et Goedert 2002 Yoshida et al. 2004). Les cellules cultivées ont été lavées deux fois avec du PBS, suivies de l'ajout de 200 µL de tampon de lyse (TBS contenant 1 % de Triton X-100) par puits (plaques à 6 puits) et maintenues sur de la glace pendant 5 min. Les lysats ont été centrifugés à 18 407 g pendant 15 min à 4°C et les surnageants résultants ajoutés à un tampon d'échantillon 5x. Après ébullition pendant 5 min, les échantillons ont été soumis à une électrophorèse sur gel de dodécylsulfate de sodium-polyacrylamide et à un immunoblot, comme décrit précédemment ( Yoshida et Goedert 2002 ).

Assemblage de microtubules

La protéine tau recombinante a été purifiée comme décrit (Yoshida et Goedert 2002). Il a été phosphorylé par BRSK1, BRSK2, MELK, MARK1 et SIK à 1 U/mL pendant 6 h à 30°C. L'assemblage des microtubules a été réalisé comme décrit (Yoshida et Goedert 2006). Les vitesses de polymérisation ont été prises comme la turbidité (absorbance à 350 nm) à 2 min après le début de la réaction.


Les effets pathologiques de la phosphorylation de tau

La phosphorylation aberrante est une caractéristique clé de la protéine tau isolée du cerveau des personnes atteintes de la MA et de nombreuses autres maladies présentant une pathologie tau. Étant donné que la phosphorylation spécifique au site module clairement la fonction et la localisation intracellulaire de tau, une phosphorylation inappropriée est probablement un événement clé dans le développement de la pathologie tau. Ci-dessous, nous soulignons certaines des conclusions relatives aux effets pathologiques de la phosphorylation de la protéine tau. Des aperçus plus complets du rôle de la phosphorylation anormale de tau dans la pathogenèse de la maladie peuvent être trouvés ailleurs (Avila et al., 2004 Iqbal et al., 2002 Shahani et Brandt, 2002).

In vitro, la pseudophosphorylation (changement de Ser en Glu) de Ser396 et Ser404 génère un tau qui est plus fibrillogène (Abraha et al., 2000), et une construction tau dans laquelle Ser422 est muté en Glu montre une propension significativement accrue à s'agréger (Haase et al., 2004). Ceci est intrigant car le traitement par Aβ des cellules cultivées provoque l'agrégation de tau, mais la mutation de Ser422 en Ala empêche l'agrégation induite par Aβ (Ferrari et al., 2003). Aβ est un peptide qui est produit par le traitement protéolytique de la protéine précurseur amyloïde (APP) et est le composant majeur des plaques séniles dans le cerveau AD. Par conséquent, ces résultats démontrent un lien entre les deux principales pathologies du cerveau AD. En effet, il existe des preuves significatives que la toxicité de l'Aβ est en amont de la pathologie tau dans la MA (Hardy, 2003).

Compte tenu de ces résultats, la phosphorylation de Ser422 peut donc jouer un rôle clé dans la formation de filaments tau in vivo. Les anticorps contre le phospho-Ser422 marquent fortement la tau du cerveau AD, mais ne marquent que faiblement la tau du cerveau humain fœtal ou adulte normal (Hasegawa et al., 1996). Dans le cerveau de la MA, l'anticorps phospho-Ser422 marque principalement les NFT intraneuronaux dans les neurones qui ont perdu leur intégrité, ainsi que les NFT extra-neuronaux (Augustinack et al., 2002). Il est intéressant de noter que la coloration des neurones « pretangle » avec l'anticorps phospho-Ser422 est rare, ce qui indique que la phosphorylation de ce site n'est pas un événement précoce dans la pathologie tau. En revanche, les neurones pretangle sont colorés avec des anticorps qui reconnaissent le phospho-Ser262 et le phospho-Thr231 (Augustinack et al., 2002), indiquant qu'une phosphorylation accrue de ces sites pourrait être un événement précoce dans la pathologie tau. Sur la base de ces résultats, on peut supposer que les événements de phosphorylation initiateurs dans l'évolution de la pathologie tau sont ceux qui diminuent l'affinité de tau pour les microtubules, augmentant le pool « libre » de tau, et sont suivis par la phosphorylation des sites qui font tau plus fibrillogène. Cependant, il convient de noter que, bien que la phosphorylation de Ser262 (et Ser214) sur tau diminue l'affinité de tau pour les microtubules, ces événements de phosphorylation inhibent la polymérisation de tau en filaments (Schneider et al., 1999). Par conséquent, tous les événements de phosphorylation tau qui conduisent à une diminution de la liaison aux microtubules ne contribuent pas au développement de la pathologie tau. Notez également que le clivage de tau par les caspases (Gamblin et al., 2003 Rohn et al., 2002) pourrait être en synergie avec des événements de phosphorylation anormaux pour conduire à la polymérisation de tau dans le cerveau AD (Fig. 2). Le fait que le tau qui a été clivé par la caspase soit plus fibrillogène que le tau complet soutient cette hypothèse (Gamblin et al., 2003).

Dans le développement de la pathologie tau, les événements de phosphorylation tau sont probablement séquentiels. Dans les premiers stades de la pathologie (« pretangle »), les événements de phosphorylation prédominants sont probablement ceux qui diminuent la capacité de tau à se lier aux microtubules plutôt que ceux qui augmentent la capacité de tau à s'auto-associer. activité de protéines kinases ou phosphatases spécifiques (Ptases). Par exemple, les neurones de pré-enchevêtrement dans le cerveau de la maladie d'Alzheimer sont marqués avec des anticorps qui reconnaissent le phospho-Thr231 et le phospho-Ser262 (Augustinack et al., 2002) et la phosphorylation de ces deux sites diminue significativement les interactions de tau avec les microtubules (Biernat et al., 1993 Cho et Johnson, 2003). Par la suite, tau peut être clivé par la caspase et/ou phosphorylé sur des sites supplémentaires tels que Ser422 (Ferrari et al., 2003 Haase et al., 2004) et Ser396/404 (Abraha et al., 2000), ce qui augmente la propension à tau pour oligomériser et finalement former des agrégats filamenteux. Le rôle exact que jouent les oligomères et les filaments de tau dans le processus de dysfonctionnement/mort cellulaire n'a pas encore été clairement défini.

Dans le développement de la pathologie tau, les événements de phosphorylation tau sont probablement séquentiels. Dans les premiers stades de la pathologie (« pretangle »), les événements de phosphorylation prédominants sont probablement ceux qui diminuent la capacité de tau à se lier aux microtubules plutôt que ceux qui augmentent la capacité de tau à s'auto-associer. activité de protéines kinases ou phosphatases spécifiques (Ptases). Par exemple, les neurones de pré-enchevêtrement dans le cerveau de la maladie d'Alzheimer sont marqués avec des anticorps qui reconnaissent le phospho-Thr231 et le phospho-Ser262 (Augustinack et al., 2002) et la phosphorylation de ces deux sites diminue significativement les interactions de tau avec les microtubules (Biernat et al., 1993 Cho et Johnson, 2003). Par la suite, tau peut être clivé par la caspase et/ou phosphorylé sur des sites supplémentaires tels que Ser422 (Ferrari et al., 2003 Haase et al., 2004) et Ser396/404 (Abraha et al., 2000), ce qui augmente la propension à tau pour oligomériser et finalement former des agrégats filamenteux. Le rôle exact que jouent les oligomères et les filaments de tau dans le processus de dysfonctionnement/mort cellulaire n'a pas encore été clairement défini.

Les protéines kinases qui contribuent à la phosphorylation pathologique de tau dans la MA et d'autres maladies neurodégénératives restent insaisissables. Il existe des preuves que GSK3β contribue à la pathologie tau dans le cerveau AD (Jope et Johnson, 2004). Il a également été rapporté que GSK3β facilite la protéolyse de l'APP pour générer Aβ (Su et al., 2004). Cependant, cette découverte est quelque peu controversée car un autre groupe a démontré que l'isoforme GSK3α est responsable de faciliter la production d'Aβ (Phiel et al., 2003). Néanmoins, il est intéressant de noter que le traitement des cellules neuronales avec Aβ entraîne une activité GSK3 accrue et une phosphorylation tau améliorée (Busciglio et al., 1995 Takashima et al., 1996 Takashima et al., 1993). Par conséquent, nous pouvons supposer que, dans la MA, les augmentations de la production d'Aβ entraînent une augmentation de l'activité de GSK3, ce qui facilite la production d'Aβ et par la suite des augmentations soutenues de l'activité de GSK3, plus de phosphorylation de tau et finalement une spirale pathogène qui entraîne une dégénérescence neuronale.

Une question importante qui reste sans réponse est le rôle que joue la phosphorylation aberrante de la protéine tau dans la cascade pathologique d'événements qui entraînent un dysfonctionnement neuronal et la mort à la fois dans la MA et dans les tauopathies. Une diminution induite par la phosphorylation de la liaison tau-microtubule contribue-t-elle au dysfonctionnement cellulaire ? Est-ce la formation d'agrégats de tau insolubles ou existe-t-il d'autres processus perturbés par une phosphorylation anormale de tau qui sont pathogènes ? De nombreuses hypothèses ont été avancées cependant, le rôle exact que joue l'hyperphosphorylation de tau dans les processus pathogènes reste incertain. Peut-être que le tau hyperphosphorylé exerce ses effets toxiques simplement en séquestrant le tau normal dans les NFT, ce qui entraîne une diminution de la stabilité des microtubules et du transport axonal (Alonso et al., 1996). Considérez également que la pathologie tau pourrait ne pas être au cœur du processus de la maladie. Par exemple, dans un modèle de souris transgénique triple qui exprime la préséniline mutante 1, l'APP mutante et la tau mutante FTDP-17 P301L, des plaques contenant Aβ et des NFT (contenant de la tau phosphorylée) sont présentes, cependant, il s'agit de l'accumulation d'Aβ intracellulaire. qui est en corrélation avec des défauts de plasticité synaptique, et non avec l'accumulation de tau phosphorylé (Oddo et al., 2003). Néanmoins, les données suggèrent que tau joue un rôle clé dans les cascades pathogènes. Par exemple, les neurones de souris tau-knockout sont résistants à la neurotoxicité induite par Aβ (Rapoport et al., 2002), et l'expression de constructions tau pseudophosphorylées dans les cellules est toxique (Fath et al., 2002). De toute évidence, des investigations supplémentaires sont nécessaires pour clarifier le rôle de la phosphorylation de la protéine tau dans la pathogenèse des maladies neurodégénératives.