Informations

Interprétation des résultats de la prédiction mFOLD

Interprétation des résultats de la prédiction mFOLD



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

J'essaie de prédire la structure secondaire de certains pré-miARN prédits via mFOLD qui est la technique généralement acceptée pour la prédiction de structure dans la plupart des études. J'ai du mal à interpréter le résultat et à accepter si le pré-miARN que j'ai choisi et le miARN que j'ai peuvent être acceptés et inclus dans mon résultat.

Il s'agit d'une structure pré-miARN prédite avec la position prédite du miARN indiquée en vert.

Est-ce une bonne/mauvaise structure et si oui, quelqu'un peut-il m'expliquer pourquoi. Merci.

edit : Je comprends que les niveaux d'énergie sont aussi quelque chose qui est recherché dans la prédiction. Dans ce chiffre particulier, G = -75,00 kcal/mol, ce qui me semble bien.

La séquence utilisée pour le pliage est

AAAAATAAAAAACAGAACCATGAGGCAGCGCACCAAGAGCGTCGTGAACGTCCGCGAATA CTTCCGCATGGACGGCAGTGGCGCCCCCGAGCAGGAGGACGACGATGACAACGATGACTG GATGGCCATCGCCATGCAGGGGCGCACCGCGTAAGGTCAGCGTGGAAGTCGCTGTAAGCCCTGG CAAGTAGAAGGCACACT

et la zone de correspondance en surbrillance est

ACGATGACACGATGAC

Donc, cette structure devrait être correcte car la séquence se situe le long d'une structure tige-boucle.

Je m'inquiète cependant de ce renflement dans le coin supérieur gauche. Cela n'affecte pas la prévisibilité de cette structure, n'est-ce pas ?


La région verte ne fera certainement pas de miARN : elle ne fait pas partie d'une tige-boucle. Voir les structures miARN typiques de miRbase.

ÉDITER

Les renflements peuvent parfois déterminer quel brin est choisi comme miARN mature. Cependant, cette région verte est également peu susceptible de former des miARN car la tige ne fait que 15 pb.


Voir la vidéo: RNA Secondary Structure Folding Prediction - RNAfold (Août 2022).