Informations

Conception d'amorce pour l'assemblage Gibson

Conception d'amorce pour l'assemblage Gibson


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

J'essaie de concevoir une amorce pour l'assemblage Gibson. Mon gène d'intérêt est sur un plasmide, et je veux copier ce gène, et le mettre dans un plasmide différent.

Je ne sais pas comment concevoir mes amorces pour la PCR. Je sais que j'ai besoin de 2 jeux d'amorces (4 au total).

  1. Amorce arrière et avant pour copier mon gène hors du plasmide qui le contient.
  2. Amorce avant et arrière pour copier le plasmide.

Je sais aussi que je dois créer des régions complémentaires de chevauchement entre mon gène et le plasmide dans lequel je veux le mettre. Comment faire ?

Voici le plasmide et le gène. Je veux placer le gène entre le préfixe et le suffixe biobrick.

Voici les amorces dont je pense avoir besoin :

Pour le plasmide dans lequel je veux mettre le gène, mes amorces doivent être

  • Effronté:ATTCGCGGCCGCTTCTAGAG
  • Inverser:CTGACGCGGCCGCTACTAGTA

Amorces pour copier le gène et ajouter un chevauchement

  • Inverser:ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT
  • Effronté:AATTAGAAAGAGATTATAATACTAGTAGCGGGCCGCTGCA

Voici le gène

Voici le plasmide dans lequel je veux le mettre. J'utilise geneious, mais je pense que pour cela, word fonctionne très bien.


Avis de non-responsabilité : je n'ai jamais fait d'assemblage Gibson, mais voici ma compréhension théorique de la façon de concevoir vos amorces. Vous avez besoin de quatre 40mères constitués chacun de segments de 20 pb dérivés du vecteur et de l'insert et correspondant aux jonctions que vous essayez de créer. Dans le schéma ci-dessous, les lignes pointillées représentent les jonctions entre les deux segments de 20 pb de chaque 40mer.


Voici un bon aperçu des considérations relatives à la conception des amorces lors de l'utilisation de l'assemblage Gibson. http://j5.jbei.org/j5manual/pages/22.html


Conception d'amorces pour assemblage Gibson - Biologie

L'outil conçoit des amorces d'une longueur de 60 nucléotides (nt). Chaque amorce comprend 20 nt de séquence spécifique du gène pour l'annelage de matrice et 30 à 40 nt de séquence de chevauchement, qui seront utilisées pour générer un chevauchement homologue entre deux fragments adjacents.

Séquences homologues de 40 pb

L'outil de conception d'amorces Gibson Assembly® générera des amorces utilisées pour ajouter des chevauchements homologues aux fragments, permettant un assemblage efficace. Les amorces sont fixées à 60 nucléotides de longueur et comprennent 20 nucléotides de séquence spécifique d'un gène pour l'annelage de matrice. Entre le vecteur et la jonction d'insertion, vous pouvez incorporer un motif de séquence, jusqu'à 10 nt de long, pour permettre la digestion de restriction. En conséquence, 30 à 40 pb de chevauchement homologue peuvent être générés après amplification par PCR. La taille du chevauchement est suffisante pour supporter un assemblage de fragments jusqu'à 10 kb, ou jusqu'à 15 fragments avec des inserts jusqu'à 1 kb chacun. L'extension du chevauchement homologue est recommandée pour l'assemblage de grands gènes.


Présentation de l'assemblage Gibson

La technique d'assemblage Gibson a été décrite pour la première fois par le Dr Daniel Gibson et ses collègues du J. Craig Venter Institute en 2009. Chez Addgene, nous avons ajouté cette option à notre menu déroulant des options de clonage courantes dans le processus de dépôt en 2014 en raison de son gain. en popularité. L'assemblage Gibson est bien connu pour permettre l'assemblage facile de plusieurs fragments d'ADN linéaires, mais peut également être utilisé dans le clonage de base d'un insert dans le vecteur de votre choix, comme le montre la figure ci-dessous. Pour commencer, vous devez avoir des fragments d'ADN avec des régions d'homologie à leurs extrémités, qui sont généralement créés par PCR. Ensuite, les fragments sont incubés avec un master mix d'enzymes, qui contient trois enzymes différentes :

  • une exonucléase, qui ronge les extrémités 5' du fragment, générant de longs surplombs qui permettent aux régions monocaténaires avec homologie de s'hybrider
  • une polymérase, pour combler les lacunes
  • une ADN ligase, pour sceller les entailles des lacunes recuites et comblées

L'avantage de ce mélange d'enzymes est qu'elles peuvent toutes fonctionner à la même température, de sorte que l'ensemble de la réaction prend une heure ou moins pour se terminer à 50 °C. Après environ une heure, l'échantillon est immédiatement prêt à se transformer en cellules compétentes. Le mélange maître d'enzymes peut être acheté auprès d'une entreprise (par exemple, NEB ou SGI-DNA), ou peut être mélangé vous-même (par exemple, voir le protocole Miller Lab). Le processus d'assemblage Gibson peut être utilisé pour assembler jusqu'à 6 fragments en une seule étape, résultant en un assemblage sans cicatrice qui ne nécessite pas la présence de sites de restriction spécifiques (ou leur absence) ni un engagement de temps sérieux. Un autre avantage est que ce processus permet de générer facilement des constructions de type sauvage et mutantes en même temps, plutôt que de manière séquentielle.


L'assemblage Gibson est un moyen courant d'insérer des fragments dans un plasmide sans utiliser d'enzymes de restriction. Pour simuler cette méthode, SnapGene fournit une interface intuitive.

Pour l'assemblage Gibson, la PCR amplifie les segments d'ADN pour créer des extrémités qui se chevauchent. Incuber ensuite les produits amplifiés avec des enzymes d'assemblage, et transformer le mélange en bactéries.

SnapGene simplifie l'assemblage Gibson en automatisant la conception des amorces. Pour planifier une réaction d'assemblage Gibson, sélectionnez simplement les fragments d'ADN que vous souhaitez joindre et SnapGene choisira les amorces appropriées.

Ces sites fournissent de plus amples informations sur Gibson Assembly :

« SnapGene nous a beaucoup aidés dans la planification de nos assemblages Gibson et des étapes de clonage de restriction, ainsi que dans la conception de notre collection de promoteurs primée. Je pense qu'il n'y a pas eu un jour où nous n'avons pas utilisé le logiciel.


Cloner à l'aide de l'assistant d'assemblage Gibson

Pour accéder à l'assistant d'assemblage, ouvrez d'abord un fichier de séquence. Au bas de votre écran, vous trouverez l'assistant d'assemblage à côté de Split Workspace. Cliquez sur Assistant d'assemblage, puis sélectionnez Créer un nouvel assemblage. Dans les options fournies, sélectionnez Gibson et appuyez sur Démarrer pour procéder à l'assemblage.

Ouvrez une séquence de backbone et cliquez sur le slot Backbone. Pour linéariser la séquence du squelette avec un site de coupure d'enzyme de restriction, cliquez sur le site de coupure, maintenez la touche Maj enfoncée et cliquez à nouveau dessus. Appuyez sur Set Fragment pour définir le backbone.

Ouvrez votre prochaine séquence d'insertion et cliquez sur le logement d'insertion. Sélectionnez toutes les bases de l'insert. Appuyez sur Set Fragment pour définir la première insertion.

Appuyez sur le bouton + à droite de l'assistant d'assemblage pour ajouter un autre insert. Ouvrez l'insert suivant et cliquez sur le nouveau logement d'insert. Encore une fois, sélectionnez toutes les bases de l'insert. Appuyez sur Set Fragment pour définir le deuxième insert.

Si vous souhaitez ajouter une séquence d'espacement comme "kozak" entre 2 insertions, cliquez sur le bouton Ajouter un espaceur après. Nommez l'espaceur « kozak » et définissez ses bases sur gccacc. Appuyez sur Enregistrer pour définir la séquence d'espacement.

Une fois votre assemblage terminé, renommez l'assemblage avec le nom de conception souhaité et appuyez sur Assembler à droite de l'assistant d'assemblage.

Sélectionnez l'emplacement de dossier souhaité pour le dossier de séquence et le dossier d'amorce. Appuyez sur Créer pour terminer l'assemblage.

Ouvrez la construction nouvellement assemblée et cliquez sur le panneau d'historique pour afficher la lignée de séquences. Notez que le squelette et les fragments d'insert sur la séquence assemblée sont colorés.

Ouvrez l'onglet Assemblage pour voir un aperçu de l'assemblage, l'imprimer ou exporter les amorces.

Si vous remplacez l'une de vos séquences dans votre site de liaison d'amorce, Benchling mettra automatiquement à jour l'amorce et affichera la mutation dans l'onglet de l'assemblage Tableau des inadéquations introduites.

Pour activer l'alignement sur la séquence assemblée ou y apporter des modifications arbitraires, ouvrez l'onglet Assemblage et appuyez sur Finaliser en haut à droite.

Remarque : L'assistant d'assemblage ne s'attend pas à ce que les bras d'homologie soient incorporés dans la dorsale/l'insert, car ils sont simplement concaténés.


Les références

Hughes RA, Ellington AD. Synthèse et assemblage d'ADN synthétique : mettre le synthétique dans la biologie synthétique. Cold Spring Harb Perspect Biol. 20179(1):1-17.

Ellis T, Adie T, Baldwin GS. Assemblage d'ADN pour la biologie synthétique : des pièces aux voies et au-delà. Intégrer Biol (Camb). 20113(2) :109–18.

Cobb RE, Ning JC, Zhao H. Techniques d'assemblage d'ADN pour la biosynthèse combinatoire de prochaine génération de produits naturels. J Ind Microbiol Biotechnol. 201441(2) :469–77.

Chao R, Yuan Y, Zhao H. Progrès récents dans les technologies d'assemblage d'ADN. FEMS Levure Res. 201515(1):1-9.

Juhas M, Ajioka JW. Assemblage d'ADN de haut poids moléculaire in vivo pour des applications de biologie synthétique. Crit Rev Biotechnol. 201737(3) :277–86.

Liang J, Liu Z, Low XZ, Ang EL, Zhao H. Assemblage d'ADN non enzymatique à double amorce : une méthode d'assemblage d'ADN en plusieurs parties efficace et précise. Acides nucléiques Res. 201745 : e94.

Jin P, Ding W, Du G, Chen J, Kang Z. DATEL : une méthode d'assemblage d'ADN sans cicatrice et indépendante de la séquence utilisant des exonucléases thermostables et de la ligase. ACS Synth Biol. 20165(9) :1028–32.

Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. Assemblage enzymatique de molécules d'ADN jusqu'à plusieurs centaines de kilobases. Méthodes Nat. 20096(5):343-5.

Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden gate shuffling: une méthode de brassage d'ADN en un seul pot basée sur des enzymes de restriction de type II. PLoS One. 20094(5):e5553.

Bitinaite J, Rubino M, Varma KH, Schildkraut I, Vaisvila R, Vaiskunaite R. Ingénierie de l'ADN conviviale et méthode de clonage par excision d'uracile. Acides nucléiques Res. 200735(6) : 1992-2002.

de Kok S, Stanton LH, Slaby T, Durot M, Holmes VF, Patel KG, Platt D, Shapland EB, Serber Z, Dean J, et al. Assemblage d'ADN rapide et fiable via une réaction de cyclage de la ligase. ACS Synth Biol. 20143(2) :97-106.

Shao Z, Zhao H. Assembleur d'ADN : un outil de biologie synthétique pour caractériser et concevoir des groupes de gènes de produits naturels. Méthodes Enzymol. 2012517 : 203-24.

Li MZ, Elledge SJ. Exploiter la recombinaison homologue in vitro pour générer de l'ADN recombinant via SLIC. Méthodes Nat. 20074(3) :251–6.

Zhang Y, Werling U, Edelmann W. SLiCE : une nouvelle méthode de clonage d'ADN à base d'extraits de cellules bactériennes. Acides nucléiques Res. 201240(8):e55.

Tillett D, Neilan BA. Clonage sans enzyme : une méthode rapide pour cloner des produits PCR indépendamment des sites d'enzymes de restriction des vecteurs. Acides nucléiques Res. 199927(19):e26.

Stevenson J, Krycer JR, Phan L, Brown AJ. Une comparaison pratique des techniques de clonage indépendantes de la ligature. PLoS One. 20138(12):e83888.

Garcia-Nafria J, Watson JF, Greger IH. Clonage IVA : un système de clonage universel à tube unique exploitant l'assemblage bactérien in vivo. Sci Rep. 20166:27459.

Liu CJ, Jiang H, Wu L, Zhu LY, Meng E, Zhang DY. Clonage OEPR : une stratégie de clonage efficace et transparente pour les fragments volumineux et multiples. Sci Rep. 20177:44648.

Zeng F, Hao Z, Li P, Meng Y, Dong J, Lin Y. Une méthode sans restriction pour la reconstitution des gènes utilisant deux PCR à amorce unique en parallèle pour générer des extrémités cohésives compatibles. BMC Biotechnol. 201717(1):32.

Cherezov V, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, et al. Structure cristalline à haute résolution d'un récepteur couplé à la protéine G bêta2-adrénergique humaine. Science. 2007318(5854):1258–65.

Ikeda H, Nonomiya T, Usami M, Ohta T, Omura S. Organisation du groupe de gènes biosynthétiques pour l'avermectine macrolide anthelminthique polykétide chez Streptomyces avermitilis. Proc Natl Acad Sci U S A. 199996 (17): 9509-14.

Garrido LM, Lombo F, Baig I, Nur EAM, Furlan RL, Borda CC, Brana A, Mendez C, Salas JA, Rohr J, et al. Aperçu des étapes de la glycosylation au cours de la biosynthèse de l'anthracycline cosmomycine antitumorale : caractérisation de deux gènes de la glycosyltransférase. Appl Microbiol Biotechnol. 200673(1):122–31.

Piel J, Hertweck C, Shipley PR, Hunt DM, Newman MS, Moore BS. Clonage, séquençage et analyse du cluster de gènes de biosynthèse de l'entérocine de l'isolat marin ‘Streptomyces maritimus’ : preuve du déraillement d'une polykétide synthase aromatique. Chem Biol. 20007(12):943–55.

He J, Hertweck C. Itération en tant qu'événement programmé lors de l'analyse moléculaire de l'assemblage de polycétides du groupe de gènes de biosynthèse de l'auréothine. Chem Biol. 200310(12):1225–32.

Yurkovich ME, Tyrakis PA, Hong H, Sun Y, Samborskyy M, Kamiya K, Leadlay PF. Un intermédiaire de stade avancé dans la biosynthèse de la salinomycine est révélé par une mutation spécifique dans le groupe de gènes biosynthétiques. Chembiochem. 201213(1) :66-71.

Dagert M, Ehrlich SD. Une incubation prolongée dans du chlorure de calcium améliore la compétence des cellules d'Escherichia coli. Gène. 19796(1):23-8.


Avantages de la technologie GeneArt Gibson Assembly Cloning

Les kits EX d'assemblage GeneArt Gibson sont idéaux pour assembler plusieurs inserts.

Figure 1. Les kits de clonage GeneArt Gibson Assembly EX offrent des options d'efficacité de transformation élevée lors de l'utilisation d'un plus grand nombre d'inserts. Assemblage de 6, 8 et 10 fragments de 0.5kb dans pcDNA 3.4 transformés en Invitrogen TOP10 Competent Cells.

Les kits GeneArt Gibson Assembly HiFi offrent un moyen très rentable et efficace d'assembler un plus petit nombre de fragments. Pour les assemblages plus importants, les Master Mix et kits GeneArt Gibson EX sont disponibles.

Figure 2. Les kits GeneArt Gibson Assembly HiFi offrent une efficacité de clonage élevée en utilisant un seul insert pour plusieurs conceptions d'inserts. Assemblage de fragments de 1, 2 et 4 - 1kb dans pCDNA 3.4 en utilisant des cellules compétentes TOP10. Les kits GeneArt Gibson Assembly HiFi sont la méthode la plus économique et la méthode la plus rapide pour construire de grands assemblages, en particulier lorsqu'ils sont utilisés avec des fragments d'ADN GeneArt Strings ou 100% séquencés, GeneArt Gene Synthesis.


Comment fonctionne l'assemblage Gibson

L'utilisation de la technologie de l'ADN recombinant a commencé peu après la découverte de l'ADN ligase et des endonucléases de restriction. Peu de temps après, l'avènement de la réaction en chaîne par polymérase (PCR) a ouvert de nouvelles possibilités d'amplification de séquences d'ADN spécifiques à partir d'un mélange complexe d'ADN génomique. Ces technologies sont un pilier du laboratoire scientifique moderne depuis plusieurs décennies et restent des méthodes utiles pour cloner de l'ADN potentiellement précieux ou intéressant aujourd'hui. Cependant, alors que les scientifiques cherchent à travailler avec des fragments d'ADN plus gros, à procéder à une réingénierie approfondie d'éléments génétiques, à synthétiser des génomes entiers et à évoluer vers des approches automatisées, les technologies nécessaires pour manipuler l'ADN doivent également évoluer.

Les chercheurs du J. Craig Venter Institute (JCVI) ont développé un certain nombre de in vitro stratégies enzymatiques pour assembler des oligonucléotides courts en des constructions d'ADN double brin plus grandes (1-4). En 2003, JCVI a réalisé une avancée significative dans la production d'un génome synthétique en assemblant le génome de 5 386 pb de phiX174, un virus qui infecte les bactéries, en seulement 14 jours (5). Cette approche impliquait de joindre des oligonucléotides synthétiques par assemblage de cycles de polymérase, puis de les amplifier par PCR (5-6). La vitesse sans précédent avec laquelle cela a été réalisé a jeté les bases de la construction de génomes plus grands et plus complexes.

En 2004, JCVI a commencé à synthétiser les Mycoplasme génital génome. Il a été découvert que les molécules d'ADN qui se chevauchent pouvaient être efficacement jointes en utilisant trois spécificités enzymatiques : (i) l'activité exonucléase, qui ronge les extrémités des fragments d'ADN et expose les surplombs d'ADN ss qui peuvent s'hybrider à leur complément ADN ss (ii) l'activité ADN polymérase, qui remplit les lacunes dans les produits recuits, et (iii) l'activité ADN ligase, qui scelle de manière covalente les entailles résultantes dans l'assemblage. Un thermocycle en deux étapes in vitro La méthode de recombinaison utilisant ces enzymes a été utilisée pour joindre 101 cassettes d'ADN chevauchantes en quatre parties du M. génital génome, chacun entre 136 kb et 166 kb. Cette étape a marqué le premier assemblage d'un génome dérivé d'un organisme vivant en liberté. À 582 970 pb, ce génome synthétique était la plus grande structure d'ADN chimiquement définie synthétisée en laboratoire et était 18 fois plus grande que tout ADN précédemment synthétisé (4).

Depuis, deux autres in vitro des méthodes de recombinaison ont été développées par JCVI pour joindre et cloner des molécules d'ADN de plus de 300 kb en une seule étape (2-4). La plus simple de ces méthodes est l'assemblage de Gibson, une approche isotherme en une étape qui utilise les trois mêmes activités enzymatiques décrites précédemment. Cette méthode peut être utilisée pour joindre à la fois ssDNA et dsDNA.

Figure 1. Présentation de l'assemblage Gibson.


L'assemblage Gibson est devenu le plus couramment utilisé des in vitro méthodes d'assemblage décrites ci-dessus, car il est facile à utiliser, flexible et ne nécessite que peu ou pas d'optimisation, même pour les assemblages volumineux et complexes. Tout ce qui est nécessaire est l'ADN d'entrée avec des chevauchements appropriés, et un mélange approprié des trois enzymes et le Gibson Assembly Master Mix. Des fragments d'ADN sont ajoutés au mélange maître et incubés à 50 ° C pendant 1 heure. Le produit d'assemblage résultant est un ADNdb entièrement scellé adapté à une gamme d'applications en aval (Figure 1). JCVI a utilisé Gibson Assembly pour synthétiser rapidement l'intégralité du génome mitochondrial de souris de 16 520 pb à partir de 600 oligonucléotides de 60 bases qui se chevauchent (3). Il a également été utilisé en combinaison avec un assemblage de levure pour synthétiser le 1,1 Mbp Mycoplasme mycoïde génome, qui a ensuite été activé dans une cellule receveuse pour produire la première cellule synthétique (1).


Voir ci-dessous pour la version consolidée.

Préparer des cartes plasmidiques

  • Faites une carte plasmidique de ce à quoi devrait ressembler votre conception terminée
    • C'est la clé. Vous en aurez besoin pour la conception d'amorces, la vérification de vos amorces, l'évaluation des réactions de séquençage, etc. J'utilise APE, un logiciel open source. Voir mes commentaires sur l'utilisation de l'APE dans Tips & Tricks.
    • La plupart du temps, cela signifie copier à partir d'autres séquences plasmidiques et coller dans un nouveau fichier plasmide.
      • Cependant, vous pouvez ajouter des éléments plus courts tels que des promoteurs et des sites de liaison au ribosome en les codant dans vos amorces.
      • Vous pouvez également ajouter des régions d'ADN plus longues en utilisant des oligos plus longs (90+ pb)
      • Vous pouvez utiliser de l'ADN génomique, généralement à partir de cellules entières (pas besoin de purifier d'abord)
      • Assurez-vous que chaque gène a un promoteur, RBS et un codon d'arrêt si vous le souhaitez.
      • Si vous n'êtes pas familier avec vos séquences, assurez-vous que la séquence n'a pas de codons d'arrêt dans le cadre avec le début.
      • Incluez le chevauchement généré par les amorces.

      Amorces de conception

      • La conception de l'amorce est la clé. Si toutes vos PCR donnent un bon rendement sans bandes indésirables dans toutes les conditions de thermocyclage testées, votre assemblage est très susceptible de bien se passer.
        • C'est toujours un bon signe lorsque les amorces fonctionnent à plusieurs températures de recuit qui sont distantes de quelques oC et à travers des concentrations de DMSO. Étant donné que l'étape d'assemblage dépend tellement de la séquence d'amorce et de l'absence de structure d'ADN simple brin (épingles à cheveux, etc.), la facilité de la PCR est un bon indicateur pour savoir si l'assemblage est susceptible de bien se dérouler.
        • Si votre colonne vertébrale ne s'amplifie pas bien, ou s'amplifie avec des produits secondaires et nécessite une purification sur gel, vous avez beaucoup moins de chances d'obtenir des assemblages réussis. Si une mauvaise PCR est générée, envisagez d'augmenter la température d'hybridation de la région de liaison pour l'amorce > 72 o C, et d'utiliser différentes zones du vecteur pour le chevauchement si possible.
        • je toujours utiliser des amorces avec Tm >72 o C pour la région de recuit. Tm les valeurs doivent toujours être calculées par le site Web de Finnzymes
          • Cette formule est applicable à l'ADN polymérase Phusion, l'ADN polymérase utilisée pour créer l'ADN que vous assemblerez.

          Vérifiez votre conception

          • Assurez-vous que les amorces directes et inverses que vous commandez correspondent à la direction prévue.
            • C'est une erreur facile à commettre.

            Trouver des conditions optimales

            Digestion Dpn1 de l'ADN matrice

            • Dpn1 devrait généralement être ajouté une fois la PCR terminée pour dégrader l'ADN matrice. Cela réduira le nombre de colonies de fond lorsque vous vous transformerez. Cela n'est généralement pas nécessaire lors de la purification de fragments sur gel, cependant, la purification sur gel doit être évitée comme discuté ici.
              • Ceci afin d'éviter le transfert de modèle.
                • Si les modèles de vos PCR sont des vecteurs de Kanamycine et que vous construisez un vecteur de Kanamycine, alors une fraction de vos transformants ne sera que des cellules avec le ou les plasmides modèles. Cela doit être gardé à l'esprit plus tard lors de l'étape de sélection.
                • Si vous avez un fragment d'un plasmide Amp et que vous construisez un vecteur Kanamycin, il n'est pas nécessaire d'ajouter Dpn1.

                0,5 ng de plasmide modèle par 25 uL de réaction PCR pour produire mon squelette, puis purifié sur colonne (pas purifié sur gel!), Et n'a pas fait de digestion Dpn1. Les colonies roses sont la matrice plasmidique passant par la purification sur colonne, jusqu'à l'étape de réaction d'assemblage et de transformation.

                Mises en garde

                • Faites très attention à utiliser la bonne combinaison d'amorces si vous amplifiez plusieurs fragments d'un plasmide ou si vos amorces fonctionnent sur des modèles utilisés pour un assemblage.
                  • Par exemple : une fois, j'ai découpé un vecteur et j'ai utilisé la mauvaise combinaison d'amorces pour le squelette. La bande sur le gel est apparue correcte (la différence de 400 pb sur un backbone de 5kb est subtile) mais a conduit à des assemblages avec une seule des deux coutures étant correcte.

                  Faire assez pour purifier et assembler

                  • Exécuter des réactions à l'échelle de purification pour fabriquer de l'ADN à assembler
                    • Si votre produit est spécifique et n'a pas besoin d'être purifié sur gel : (ne nécessite qu'un nettoyage par PCR)
                      • 20uL d'insert fortement amplifié suffisent amplement. Faites un peu plus (30 uL) si c'est l'épine dorsale. Ces quantités produisent généralement beaucoup d'ADN pour plus de 5 assemblages, permettant ainsi la possibilité de plusieurs tentatives.
                      • fonctionner plus comme 60-120 ul, selon la gravité des sous-produits.

                      Purifier les fragments PCR

                      • La meilleure façon de purifier les produits PCR est un simple nettoyage de la colonne. Nous utilisons le kit de nettoyage Qiagen PCR et éluons dans de l'eau.
                        • Cela nécessite généralement que vos PCR soient très spécifiques à la taille de bande que vous vouliez. C'est pourquoi les amorces PCR sont réalisées avec des températures de fusion de 70 o C : faire un annelage à haute température (67-70 o C) est le moyen le plus probable de vous donner l'amplification PCR souhaitée. Vous devez avoir vérifié
                        • Cela éliminera les dimères d'amorces et les bandes indésirables. Malheureusement, les kits d'extraction de gel sur colonne ont une efficacité extrêmement faible. Vous pouvez éluer dans de l'eau ou dans le tampon fourni par le kit (en supposant qu'il ne s'agisse que de 10 mM de Tris, pH 8,5 et n'a pas d'EDTA), mais j'ai toujours utilisé de l'eau.
                        • Eluer dans 30 uL (pas 50 uL) pour fournir un produit concentré.

                        100 ul de produit PCR donnent généralement

                        Fragments de PCR Nano Drop

                        • Exécutez 1,5 ul sur une machine NanoDrop pour approximer la concentration d'ADN de chaque éluat.
                        • Vous pouvez utiliser le test de 1,5 uL sur la machine dans un gel d'agarose pour confirmer que les produits ont l'air bien et qu'ils n'ont pas été accidentellement mélangés lors de la purification.
                        • Exemple:

                        Réaction d'assemblage Gibson

                        • ajoutez vos produits PCR purifiés et ajoutez de l'eau pour atteindre la concentration souhaitée comme spécifié par votre kit commercial ou votre recette maison.
                          • Le kit disponible dans le commerce fonctionne

                          Transformation

                          • L'électroporation est généralement utilisée, car elle peut vous donner une efficacité beaucoup plus élevée. Cependant, certaines personnes utilisent des cellules chimiquement compétentes, ce qui peut suffire si l'assemblage est plus simple. La quantité d'ADN que vous transformez et si vous devez d'abord le dessaler dépend de l'efficacité d'assemblage attendue et de la toxicité du produit.
                          • Dessaler l'ADN pendant 15 minutes sur des filtres millipore signifie que vous pouvez ajouter plus d'ADN aux électroporations et éviter les arcs électriques.
                            • Nous utilisons du papier de dessalage Millipore, article # VSWP01300 pour dessaler des réactions de 12 à 20 uL et Millipore # VSWP02500 pour des volumes plus importants. Placez l'ensemble au-dessus d'un filtre qui flotte au-dessus de l'eau.
                            • Aaron Puri attend 15 minutes de dessalage et électroporation à 1,6 kV sans arc électrique. -6/2015. Il n'y a aucun mal à les laisser plus longtemps.

                            • Peut être beaucoup plus efficace que les cellules chimiquement compétentes.
                            • Utilisation

                            • Si vous avez utilisé le mélange d'assemblage commercial et que votre conception (a) n'est pas trop compliquée (trop de pièces, un produit final trop gros, trop toxique pour les gènes) et (b) est transformée en de très bonnes cellules électrocompétentes (concentrées), alors 1-2 ul peuvent vous donner assez de colonies pour avoir une pelouse.
                            • Vous voudrez peut-être transformer certains ONU-fragments assemblés, pour avoir une idée de ce qu'est l'arrière-plan de la transformation réelle. (Certaines des colonies qui se développent sur la plaque de transformation auront un ADN matrice, pas la construction souhaitée, malgré la digestion par Dpn1.
                            • Si vous étalez des plasmides conférant une résistance à l'ampicilline, appliquez de la carbénicilline et non de l'ampicilline.
                              • L'ampicilline est connue pour donner des colonies satellites ou même des pelouses de bactéries non résistantes. Ceci est particulièrement problématique si votre plasmide assemblé entraîne une croissance lente, car les bactéries non résistantes auront tout le temps de prospérer. Si vos cellules électrocompétentes sont bonnes, alors la densité cellulaire élevée conduira probablement à une pelouse de bactéries sur une plaque Amp, même si la plupart des bactéries ne sont pas résistantes aux Amp. Vous pouvez plaquer une petite fraction de votre électroporation sur Amp, mais cela suppose que vous ayez une efficacité d'assemblage élevée et un plasmide à faible charge (par exemple, un promoteur doux + RFP, pas un promoteur à haute résistance et plusieurs enzymes).

                              Dépistage : Colony PCR

                              Utilisez la PCR de colonie pour générer des fragments PCR qui confirmeront votre assemblage.

                              • N'utilisez pas Phusion pour cela, c'est beaucoup trop précieux.
                              • J'utilise le mélange PCR [2X OneTaq http://www.neb.com/nebecomm/products/productM0486.asp] pour plusieurs raisons :
                                • C'est bon marché
                                • Il peut être conservé au réfrigérateur, décongelé, pendant des mois sans danger.
                                • Il a déjà un colorant de chargement, donc le chargement dans des gels d'agarose pour l'observation est accéléré.
                                • Conseil: Préparez environ 1/2 ml d'eau et d'amorces PCR de colonie dans des proportions appropriées pour le mélange final 1x. Voir cette feuille de calcul pour les proportions de mélange. Allez-y et préparez 1/2 ml, vous serez peut-être heureux d'en avoir plus plus tard et l'eau/les apprêts sont presque gratuits. Vous pouvez conserver les restes au réfrigérateur indéfiniment. J'étiquette le mien OneTaq 212 213 si j'ai mélangé les amorces 212 et 213. Ensuite, lorsque vous effectuez une PCR sur colonie, vous pouvez ajouter 6 ul de ce mélange dans chaque puits, dissoudre les cellules dans chaque puits et ajouter 6uL du mélange 2x sur le dessus.
                                • Alternativement, vous pouvez faire un mélange 1x (ajouter l'eau et les apprêts nécessaires) et utiliser le mélange après de nombreux cycles de gel-dégel.
                                • PCR sur une région d'une longueur différente de celle de n'importe lequel de vos plasmides modèles. Cela vous permettra de savoir quels sont les assemblages réussis et ceux qui sont des modèles de report.
                                  • Si vous avez modifié un gène dans un plasmide et que la taille du gène est différente, effectuez une PCR pour la longueur de cette région.
                                    • Vous pouvez effectuer une PCR sur l'ensemble de l'insert si vous l'avez inséré dans un vecteur vide et vos modèles ne s'amplifieront pas pour donner les mêmes tailles de produits.
                                    • Vous pouvez décider de réétaler les colonies que vous avez testées avant ou après l'obtention de vos résultats. Je repasse toujours une fois, dans le but d'obtenir des colonies uniques, afin de réduire la probabilité que ma miniprep soit une population mixte.
                                      • Je plaque en même temps que j'échantillonne si :
                                        • Je pense que la fraction qui réussit (pas de modèle) sera élevée
                                        • J'exécute la PCR pendant la nuit et je n'obtiendrai les résultats que le matin.
                                        • Je pense que les résultats seront principalement le transfert du plasmide modèle
                                        • J'aurai l'occasion d'exécuter les produits PCR dans un gel avant de partir pour la journée, me permettant de ne refaire que les « gagnants ».
                                        1. Décidez du nombre de colonies que vous souhaitez dépister. Préparez une bandelette PCR (ou des bandelettes) avec les puits numérotés et correspondant aux numéros de colonie.
                                          1. J'utilise des ensembles de 12, car mes gels d'agarose ont suffisamment de voies pour cela et deux voies d'échelle. Vous utiliserez au moins un des puits pour amplifier l'ADN matrice en tant que contrôle. Je fais plus de colonies (jusqu'à 33-34) si je m'attends à ce que le transfert du modèle soit un problème, ou si les gènes sont toxiques et que les assemblages réussis rendent les cellules malsaines.
                                          2. Si vous refaites chaque colonie testée, préparez vos assiettes maintenant. Je divise l'assiette en 6 formes de tarte.
                                          1. Si vous replaquez au début, marquez également les zones des tranches de tarte avec ces mêmes numéros.
                                          1. Si vous refaites des colonies maintenant : essuyez un peu de la colonie sur la plaque, puis dissolvez le reste dans le puits PCR numéroté correspondant.
                                          2. Si vous ne refaites pas de colonies maintenant, essayez de laisser un peu de biomasse sur la plaque, mais soyez rassuré, il reste toujours des cellules à moins que vous n'ayez vraiment percé un trou dans l'agarose.
                                          3. Il est possible de le surcharger si vous avez de très grosses colonies et d'en aspirer beaucoup avec la pointe de la pipette.
                                          4. Une fois qu'une colonie donnée a été dissoute dans un puits PCR, éjectez la pointe de la pipette dans le puits situé derrière. En plus d'avoir chaque puits numéroté et les colonies numérotées et encerclées sur la plaque de transformation, il s'agit d'une garantie supplémentaire pour garantir qu'une seule colonie est mise dans chaque réaction PCR.

                                          Séquençage

                                          • Sélectionnez 2-4 colonies pour le séquençage en fonction de la PCR de colonie
                                          • Séquencez d'abord les coutures de l'assemblage Gibson.
                                          • Séquencez les autres régions, car il est possible qu'une erreur PCR ait été introduite
                                            • Habituellement, lorsqu'une "erreur" est trouvée, elle était en fait présente sur le modèle.

                                            Concevoir des amorces pour Gibson Assembly avec MacVector 17

                                            MacVector 17 dispose d'un tout nouvel outil pour la conception automatisée de stratégies de clonage indépendantes de la ligase. L'outil prend en charge l'assemblage Gibson piloté par l'exonucléase 5' ainsi que l'approche "Ligase Independent Cloning" de l'exonucléase 3' de l'ADN polymérase T4. MacVector peut concevoir automatiquement des amorces lorsque vous spécifiez des fragments et des vecteurs à utiliser. Vous pouvez fournir des amorces personnalisées (manuellement ou à partir d'outils tels que le site Web NEBuilder). Vous pouvez également simplement fournir des fragments existants avec des extrémités qui se chevauchent pour que MacVector puisse les assembler. L'interface montre la structure exacte des jonctions entre les fragments, y compris les traductions CDS pertinentes pour confirmer le cadre des fusions de protéines. La stratégie de clonage peut être enregistrée en tant que nouveau document de projet de clonage et finalement assemblée automatiquement en une seule séquence pour l'exportation.

                                            MacVector 17 a été publié en février 2019. Il contient de tout nouveaux outils pour comparer les génomes, faciliter le clonage d'enzymes de restriction, concevoir automatiquement des stratégies de clonage Gibson/LIC, mettre en évidence les problèmes d'assemblage, comparer plusieurs ensembles de données de séquences avec une seule référence et créer encore plus de cartes de plasmides. magnifique, en affichant vos propres sites de liaison d'amorces ! Enfin, MacVector 17 prend en charge le mode sombre de macOS Mojave pour faciliter la concentration sur ces sessions de conception d'amorces de fin de soirée !


                                            Données de performance

                                            Découvrez comment NEBuilder HiFi surpasse NEB Gibson Assembly.

                                            Efficacité et précision améliorées

                                            Fidélité améliorée

                                            Un ou plusieurs de ces produits sont couverts par des brevets, des marques commerciales et/ou des droits d'auteur détenus ou contrôlés par New England Biolabs, Inc. Pour plus d'informations, veuillez nous envoyer un e-mail à l'adresse [email protected] . L'utilisation de ces produits peut nécessiter l'obtention de droits de propriété intellectuelle supplémentaires de tiers pour certaines applications. .

                                            GIBSON ASSEMBLY® est une marque déposée de Synthetic Genomics, Inc.



Commentaires:

  1. Dogar

    Vous vous êtes éloigné de la conversation

  2. Kaliq

    Ne soyez pas dupe à ce sujet.

  3. Sabar

    C'est dommage que je ne puisse pas parler maintenant - il n'y a pas de temps libre. Je reviendrai - j'exprimerai certainement mon opinion sur cette question.

  4. Goltilrajas

    Oui tu as du talent :)



Écrire un message