Informations

Comment l'ARN du rétrovirus est-il converti en ADNc ?

Comment l'ARN du rétrovirus est-il converti en ADNc ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Le rétrovirus (oncovirus) contient de l'ARN. Il possède également une molécule appelée transcriptase inverse. Cette molécule transcrit l'ARN en ADNc. Cet ADNc est la copie d'ADN du génome de l'ARN viral

L'ARN a de l'uracile au lieu de la thymine et l'ADN a de la thymine au lieu de l'uracile. Alors, comment l'ARN peut-il être converti en ADN ? Où va l'uracile et d'où vient la thymine ?


L'ARN a de l'uracile au lieu de la thymine et l'ADN a de la thymine au lieu de l'uracile. Alors, comment l'ARN peut-il être converti en ADN ?

Je pense que vous voudrez peut-être poser une question plus fondamentale. L'ADN et l'ARN sont extrêmement similaires, seul un oxygène fait la différence. Cela a de vastes conséquences pour les organismes, et la vie telle que nous la connaissons utilise l'ADN et l'ARN à des fins très distinctes. L'ADN stocke le génome fournissant les instructions pour la vie, et l'ARN en un mot est la façon dont ce message est converti en protéine pour une action utile. L'ARN est généralement moins stable que l'ADN, donc cet arrangement fonctionne bien.

L'ADN étant régulièrement et constamment transcrit en ARN, la thymine est donc régulièrement utilisée en faveur de l'uracile. Il y a un fantastique répondez ici sur Biology.SE traitant déjà de Pourquoi donc je suggère de le lire. Les comment est assez simple, il existe différentes molécules utilisées ! Les ADN polymérases incorporent la thymine tandis que les ARN polymérases incorporent l'uracile. La transcriptase inverse qui est codée par le rétrovirus fait exactement cela : elle transcrit l'ARN en ADN, en utilisant la thymine au lieu de l'uracile. L'uracile et la thymine sont tous deux présents dans la cellule et peuvent donc être utilisés.


Je pense qu'il pourrait être utile de vous montrer la différence entre l'uracile et la thymine

Ce sont des structures très similaires. La partie impliquée dans l'appariement des bases est en fait l'azote et l'oxygène le plus éloigné du sucre. Voir ci-dessous:

Donc, avoir un groupe méthyle supplémentaire de l'autre côté de la molécule n'interrompt pas l'appariement des bases. Et rappelez-vous, avec la synthèse d'ADN/ARN, vous avez un modèle, et le nouveau brin est basé sur le modèle. Ainsi, lorsque l'enzyme RT mentionnée par Medhat rencontre une adénine dans l'ARN matrice, elle l'associe à une thymidine. Et lorsqu'il rencontre un uracile, il est capable de l'associer à une adénine. L'enzyme est structurée spécifiquement pour n'autoriser que la thymine et non l'uracile, c'est ainsi qu'elle fait la distinction.


Synthèse d'ADNc

Quelles que soient vos exigences, il existe un kit de synthèse d'ADNc Bio-Rad qui répond à vos besoins.

Synthèse d'ADNc de Reliance Select
Trousse

Sélectionnez le kit de synthèse d'ADNc Reliance Select pour capturer des cibles riches en GC et une structure secondaire dans des échantillons FFPE et difficiles avec de l'ARN dégradé ou des inhibiteurs.

Supermix de transcription inverse
pour RT-qPCR

Choisissez le supermix de transcription inverse iScript pour une synthèse d'ADNc rapide, efficace et sensible pour la RT-qPCR et un seul tube et un protocole de 40 minutes.

Kit avancé de synthèse d'ADNc
pour RT-qPCR

Choisissez le kit de synthèse d'ADNc avancé iScript qui a une plage dynamique étendue avec une capacité allant jusqu'à 7,5 µg d'ARN d'entrée.


Comment l'ARN du rétrovirus est-il converti en ADNc ? - La biologie

Cette enzyme transcriptase inverse nous permet d'utiliser une matrice d'ARN pour produire une copie d'ADNc double brin. La transcriptase inverse a été découverte par H. Temin et D. Baltimore lors de l'étude des rétrovirus. Les rétrovirus contiennent un génome d'ARN qui est converti en une copie d'ADN et intégré dans le génome de l'hôte au cours de son cycle de réplication. Il s'agit d'un ensemble intéressant de virus comprenant de nombreux virus tumoraux et le virus du SIDA VIH.

La transcriptase inverse est une ADN polymérase dépendante de l'ARN. Il utilise l'ARN comme matrice, nécessite des dNTP et une amorce (libre 3' OH) pour initier la polymérisation de l'ADN.

Deux types d'apprêt sont couramment utilisés.

Oligo-dT initie l'amorçage à partir de l'extrémité 3' des ARNm.
Les ADNc amorcés avec l'oligo-dT sont enrichis pour les extrémités 3' de l'ARNm.

Les oligonucléotides aléatoires peuvent s'hybrider n'importe où le long de la séquence d'ARNm et amorcer la synthèse d'ADNc. Les ADNc amorcés de manière aléatoire sont distribués le long de la matrice et sont donc plus représentatifs de la population d'ARNm.

Les ARNm sont généralement courts (par rapport au génome) - la plupart des ARNm ont moins de 6 kb de longueur et seuls les rares ARNm dépassent 10 kb de longueur.
Cette petite taille signifie que les vecteurs d'insertion de plasmides et de phages sont appropriés pour la construction de bibliothèques d'ADNc
(contrairement aux bibliothèques génomiques où les vecteurs de substitution de phage sont préférés).

Dans notre discussion sur les bibliothèques génomiques, nous nous sommes concentrés sur la couverture complète du génome.
Des fragments génomiques aléatoires ont été générés par digestion partielle avec une enzyme de coupe fréquente.
La bibliothèque de fusils de chasse aléatoire résultante contient plusieurs clones qui se chevauchent et qui couvrent la séquence complète du génome.

Les bibliothèques d'ADNc sont un peu différentes.
Ici, chaque transformant bactérien ou phage emballé représente une molécule d'ARNm unique.
Les recombinants contenant la même séquence d'ADN représentent différentes molécules matrices présentes dans la population d'ARNm d'origine.

Par exemple, il y a 100 000 molécules d'ARNm dans la cellule à un moment donné
10% d'entre eux sont des ARNm fortement exprimés (disons des ARNm d'actine)
puis dans une banque d'ADNc primaire constituée de 100 000 clones,
10% d'entre eux (10 000) seront des ADNc d'actine.
Ou vous pouvez simplement cribler quelques centaines d'ADNc et toujours trouver des ADNc d'actine.

Eh bien, c'est très bien si vous voulez étudier l'actine.

Que faire si vous souhaitez étudier un facteur de transcription rare qui n'est exprimé qu'à de faibles niveaux.
Dans vos 100 000 ARNm, il peut n'y avoir que 10 ARNm codant pour votre facteur de transcription.
Maintenant, vous devrez filtrer toute votre bibliothèque de 100 000 clones.

Si votre relevé de notes n'a été exprimé que pendant une courte période à des niveaux faibles, il pourrait être présent à des niveaux encore plus bas.

La majorité des phages recombinants dans une banque d'ADNc standard portent des séquences fortement exprimées.
Les ARNm rares sont difficiles à trouver à moins que votre bibliothèque ne soit très grande (nombre de recombinants - devrait contenir plus de 10 6 recombinants indépendants pour couvrir une population d'ARNm de 100 000 transcrits avec une probabilité de 99%).

L'alternative au criblage d'un nombre croissant de recombinants indépendants est de « normaliser » la bibliothèque en utilisant la cinétique d'hybridation comme nous en avons discuté précédemment.
Les bibliothèques normalisées contiennent moins de copies d'ARNm hautement exprimés (supprimés lors de l'hybridation) et plus de copies de transcrits rares (dans un sens relatif).


Rétrovirus

Nos rédacteurs examineront ce que vous avez soumis et détermineront s'il faut réviser l'article.

Rétrovirus, n'importe lequel d'un groupe de virus appartenant à la famille des Retroviridae et qui portent de manière caractéristique leur empreinte génétique sous la forme d'acide ribonucléique (ARN). Les rétrovirus portent le nom d'une enzyme connue sous le nom de transcriptase inverse, découverte indépendamment en 1971 par les virologues américains Howard Temin et David Baltimore. La transcriptase inverse transcrit l'ARN en acide désoxyribonucléique (ADN), un processus qui constitue une inversion du sens habituel de la transcription cellulaire (ADN en ARN). L'action de la transcriptase inverse permet au matériel génétique d'un rétrovirus de s'incorporer de façon permanente dans le génome d'ADN d'une cellule infectée. L'enzyme est largement utilisée dans les sciences biologiques pour synthétiser des gènes.

Les rétrovirus provoquent la croissance tumorale et certains cancers chez les animaux et sont associés à des infections lentes des animaux, telles que l'anémie infectieuse des équidés. Chez l'homme, un rétrovirus connu sous le nom de virus lymphotrope humain à cellules T de type 1 (HTLV-1) provoque une forme de cancer appelée leucémie à cellules T de l'adulte (ATL). Il peut également provoquer une maladie neurodégénérative connue sous le nom de myélopathie associée au HTLV-1/paraparésie spastique tropicale (HAM/TSP). Un virus étroitement apparenté nommé HTLV-2 est associé à des troubles neurologiques relativement bénins mais n'a pas été identifié comme un agent causal de la maladie humaine. On pense que jusqu'à 20 millions de personnes dans le monde sont infectées par les HTLV, mais seul un petit pourcentage d'individus infectés développent réellement ATL ou HAM/TSP. Le rétrovirus connu sous le nom de virus de l'immunodéficience humaine (VIH) provoque le syndrome d'immunodéficience acquise (SIDA) chez l'homme. Le VIH est étroitement lié au virus de l'immunodéficience simienne (VIS), un rétrovirus trouvé chez les chimpanzés et les gorilles.

Les rétrovirus endogènes (ERV) sont des caractéristiques persistantes du génome de nombreux animaux. Les VRE sont constitués du matériel génétique de virus éteints, ou « fossiles », dont la constitution génomique est similaire à celle des rétrovirus existants. Les ERV humains (HERV) se sont distribués dans l'ADN humain au cours de l'évolution. Ils sont transmis d'une génération à l'autre et représentent environ 1 à près de 5 pour cent du génome humain. Les HERV sont soupçonnés d'avoir influencé l'évolution de certains éléments du génome humain. Ils ont également été impliqués dans certaines maladies humaines, dont la sclérose en plaques.

HTLV-1 a été le premier rétrovirus humain à être découvert, ayant été détecté et isolé en 1979 par le virologue américain Robert C. Gallo et ses collègues. Le VIH a été isolé pour la première fois en 1983.


L'occurrence généralisée et les rôles biologiques potentiels des éléments viraux endogènes dans les génomes des insectes

Les approches modernes de séquençage génomique et de bioinformatique ont détecté de nombreux exemples de séquences d'ADN dérivées de génomes de virus à ADN et à ARN intégrés dans les génomes des vertébrés et des insectes. Les rétrovirus codent pour des ADN polymérases dépendantes de l'ARN (transcriptases inverses) et des intégrases qui convertissent leurs génomes viraux à ARN en provirus à ADN et facilitent l'intégration de l'ADN proviral dans le génome hôte. Étonnamment, des séquences d'ADN dérivées de virus à ARN qui ne codent pas pour ces enzymes sont également présentes dans les génomes de l'hôte. Les séquences de virus à ARN intégré non rétroviral (NIRVS) se produisent à une fréquence relativement élevée dans les génomes des vecteurs arboviraux Aedes aegypti et Aedes albopictus, ne sont pas distribués au hasard et contribuent peut-être à l'immunité antivirale des moustiques, suggérant que ces moustiques pourraient servir de système modèle pour démêler la fonction de la NIRVS. Ici, nous abordons les questions suivantes : Qu'est-ce qui motive la synthèse d'ADN à partir des génomes des virus à ARN non rétroviraux ? Comment se produit l'intégration de l'ADNc du virus dans l'ADN de l'hôte et quelle est sa fonction biologique (le cas échéant) ? Nous passons en revue les connaissances actuelles sur les intégrations virales dans les génomes des insectes, émettons des hypothèses sur les mécanismes de formation de la NIRVS et leur impact potentiel sur la biologie des insectes, en particulier l'immunité antivirale, et suggérons des orientations pour les recherches futures.


Des rétrovirus « vieux de près d'un demi-milliard d'années »

Un rétrovirus a une membrane contenant des glycoprotéines, qui sont capables de se lier à une protéine réceptrice sur une cellule hôte. Il y a deux brins d'ARN dans la cellule qui ont trois enzymes : la protéase, la transcriptase inverse et l'intégrase (1). La première étape de la réplication est la liaison de la glycoprotéine à la protéine réceptrice (2). Une fois ceux-ci liés, la membrane cellulaire se dégrade et fait partie de la cellule hôte, et les brins d'ARN et les enzymes pénètrent dans la cellule (3). Dans la cellule, la transcriptase inverse crée un brin d'ADN complémentaire à partir de l'ARN du rétrovirus et l'ARN est dégradé. Ce brin d'ADN est connu sous le nom d'ADNc (4). L'ADNc est ensuite répliqué et les deux brins forment une liaison faible et pénètrent dans le noyau (5). Une fois dans le noyau, l'ADN est intégré à l'ADN de la cellule hôte à l'aide de l'intégrase (6). Cette cellule peut soit rester en sommeil, soit l'ARN peut être synthétisé à partir de l'ADN et utilisé pour créer les protéines d'un nouveau rétrovirus (7). Les unités ribosomales sont utilisées pour transcrire l'ARNm du virus dans les séquences d'acides aminés qui peuvent être transformées en protéines dans le réticulum endoplasmique rugueux. Cette étape fabriquera également des enzymes virales et des protéines de capside (8). L'ARN viral sera fabriqué dans le noyau. Ces morceaux sont ensuite rassemblés et pincés de la membrane cellulaire sous la forme d'un nouveau rétrovirus (9). Crédit : Wikipédia/CC BY-SA 3.0

Les rétrovirus - la famille de virus qui comprend le VIH - ont près d'un demi-milliard d'années, selon de nouvelles recherches menées par des scientifiques de l'Université d'Oxford. C'est plusieurs centaines de millions d'années plus vieux qu'on ne le pensait auparavant et suggère que les rétrovirus ont des origines marines anciennes, ayant été avec leurs hôtes animaux à travers la transition évolutive de la mer à la terre.

Les résultats, rapportés dans le journal Communication Nature, nous aidera à mieux comprendre la « course aux armements » continue entre les virus et leurs hôtes.

L'auteur de l'étude, le Dr Aris Katzourakis, du département de zoologie de l'Université d'Oxford, a déclaré : « On sait très peu de choses sur l'origine ancienne des rétrovirus, en partie à cause de l'absence de fossiles géologiques. Les rétrovirus sont largement distribués parmi les vertébrés et peuvent également se transmettre entre les hôtes. , conduisant à de nouvelles maladies telles que le VIH, et il a été démontré qu'ils sont capables de sauter entre des hôtes distants comme les oiseaux et les mammifères. âge.

"Nos nouvelles recherches montrent que les rétrovirus ont au moins 450 millions d'années, sinon plus, et qu'ils doivent être apparus avec, sinon avant, leurs hôtes vertébrés au début de l'ère paléozoïque. De plus, ils auraient été présents dans notre ancêtres vertébrés avant la colonisation des terres et ont accompagné leurs hôtes tout au long de cette transition de la mer à la terre, jusqu'à nos jours.

Les rétrovirus sont une famille de virus qui comprend le virus VIH responsable de la pandémie du SIDA. Ils peuvent également provoquer des cancers et des immunodéficiences chez divers animaux. La partie «rétro» de leur nom vient du fait qu'ils sont constitués d'ARN, qu'ils peuvent convertir en ADN et insérer dans le génome de leur hôte - la direction opposée au flux normal d'informations dans une cellule. Cette propriété signifie qu'ils peuvent parfois être hérités en tant que rétrovirus endogènes (rétrovirus avec une origine interne), formant un enregistrement fossile génomique virtuel qui peut être utilisé pour revenir sur leur histoire évolutive.

Cette recherche a utilisé des séquences génomiques de rétrovirus endogènes qui ressemblent aux virus « mousseux » - un groupe de virus qui ont tendance à diverger avec leurs hôtes. Les virus mousseux sont répandus chez les mammifères, et dans cette étude, les chercheurs ont mis au jour des fossiles génomiques de rétrovirus de type mousseux chez des hôtes très divers, notamment des poissons à nageoires rayonnées et des amphibiens chez lesquels ils n'avaient jamais été trouvés auparavant.

Au cours de cette étude, les chercheurs ont surmonté l'une des principales limites de l'étude de l'histoire évolutive profonde des virus : leur évolution rapide. Ce trait facilite la reconstruction de l'histoire récente des virus mais obscurcit leur passé plus lointain. Cependant, un nouveau modèle utilisé dans cette recherche - en combinaison avec les enregistrements fossiles génomiques des virus de type mousseux - a permis aux scientifiques de rendre compte d'un ralentissement apparent du taux d'évolution au fur et à mesure qu'ils remontaient.

Le Dr Katzourakis a ajouté : "Ces résultats montrent que ce groupe de virus médicalement important a au moins un demi-milliard d'années - bien plus vieux qu'on ne le pensait auparavant. Ils remontent aux origines des vertébrés, et cela nous donne le contexte dans lequel nous devons considérer leur activité actuelle et leurs interactions avec leurs hôtes. Par exemple, nous devons considérer les adaptations que les vertébrés ont développées pour lutter contre les virus, et les contre-mesures virales correspondantes, comme le produit d'une course aux armements continue qui remonte à des centaines de des millions d'années.

"Notre date inférée des origines des rétrovirus coïncide avec les origines de l'immunité adaptative, et il est donc probable que les rétrovirus aient joué un rôle important dans l'émergence de cet outil clé dans la défense antivirale des vertébrés. Comme nous comprenons la nature de l'interaction entre virus et l'immunité de l'hôte, nous serons mieux placés pour intervenir dans cette course aux armements délicatement équilibrée afin de développer de nouveaux traitements et interventions.

"Et alors que nous construisons une image plus claire des origines des divers groupes de virus qui nous infectent aujourd'hui, nous devrions nous rapprocher du mystère de leurs origines ultimes."


Composants utilisés dans la RT-qPCR :

La sélection des composants pour la PCR à transcription inverse est aussi cruciale que la sélection des conditions de température, mais ne vous inquiétez pas, le kit PCR à transcription inverse prêt à l'emploi contient tous les ingrédients dans le tampon de réaction et le mélange réactionnel.

La sélection de chaque ingrédient PCR et sa quantité est aussi importante que la sélection des conditions de température pour la PCR. De nos jours, les kits PCR de transcription inverse prêts à l'emploi rendent votre travail efficace car ils contiennent tous les ingrédients. Voyons quelques composants de la RT-PCR,

  • Enzyme transcriptase inverse avec activité RNase
  • RNase H (si la transcriptase inverse ne l'a pas)
  • ADN polymérase

Résumé

De nombreux virus transportent plus d'un segment d'acide nucléique dans la particule du virion, mais les rétrovirus sont le seul groupe connu de virus qui contiennent deux copies identiques (ou presque identiques) du génome d'ARN dans le virion. Ces génomes d'ARN sont liés de manière non covalente par un processus connu sous le nom de dimérisation de l'ARN génomique. De manière unique, la dimérisation de l'ARN du génome rétroviral est d'une importance cruciale pour une réplication rétrovirale efficace. Dans cet article, notre compréhension actuelle de la relation entre la conformation du génome rétroviral, la dimérisation et la réplication est passée en revue.


Étape 7 : Analyse des données

A. Normalisation des données𠅌omparatif Cq méthode

L'importance de la normalisation des données qPCR a été soulignée à plusieurs reprises [1, 26]. La normalisation des données est une étape critique du flux de travail qPCR, car elle corrige les variations de plusieurs étapes, notamment la purification de l'ARN, l'évaluation de la concentration en ARN, ainsi que l'efficacité de la transcription inverse et de l'amplification. Normalisation avec des gènes de référence exprimés de manière stable comme contrôles internes, connue sous le nom de C comparatifq ou le Δ㥌q méthode, est la méthode la plus courante pour la normalisation des données d'ARNm. Cependant, cette technique nécessite une validation appropriée pour s'assurer qu'elle est exécutée correctement [27]. Pour le comparatif Cq méthode pour être valide, il est important de s'assurer que les gènes de référence et les gènes cibles ont une efficacité d'amplification similaire, en tant que C comparatif valideq La méthode est basée sur une hypothèse supplémentaire d'efficacité d'amplification similaire [28]. Une courbe standard peut être tracée pour le 㥌q (la différence entre le gène de référence et le gène cible par rapport au log de l'entrée d'ADNc), et la valeur absolue de la pente doit être π.1 [29]. Voir un exemple de 㥌q entre Cyclophiline et PGC-1α dans la figure 6 . S'il n'est pas possible d'obtenir des gènes de référence avec une efficacité d'amplification similaire à celle de la cible, il est suggéré d'utiliser la méthode de calcul de Pfaffl, dans laquelle le calcul est ajusté par les différences d'efficacité d'amplification des gènes cible et de référence [30, 31].

Le comparatif Cq méthode normalise le Cq valeur d'un gène cible par rapport aux gènes de référence internes avant que des comparaisons soient faites entre les échantillons. Premièrement, la différence entre Cq valeurs (㥌q) du gène cible et la moyenne géométrique de plusieurs gènes de référence est calculée pour chaque échantillon, puis la différence dans le 㥌q (Δ㥌q) est calculé entre deux échantillons (par exemple, contrôle et traitement, ou pré et post traitement). Le facteur de changement dans l'expression des deux échantillons est calculé comme 2 -Δ㥌q , où 2 dérive de 1 + efficacité et l'efficacité est supposée être 1 (c'est-à-dire, 100% d'efficacité) [28]. Notre recommandation pour l'utilisation du comparatif Cq méthode est énumérée dans l'encadré 9.

Encadré 9

Il est important de s'assurer que les gènes de référence et les gènes cibles ont une efficacité d'amplification similaire lors de l'utilisation du C comparatif.q sinon la méthode Pfaffl doit être envisagée.

B. Choix des gènes de référence

Plusieurs gènes de référence traditionnels ont été largement utilisés dans l'analyse qPCR. Un article de synthèse a rapporté que 33% et 32% de l'analyse d'expression de 6 revues à fort impact utilisées glycéraldéhyde-3-phosphate déshydrogénase (GAPDH) et bêta d'actine (ACTB) comme gènes de référence respectivement pour les articles publiés en 1999 [32]. Cependant, la même revue a souligné que l'expression des deux GAPDH et ACTB varie considérablement sous différents paramètres expérimentaux dans une gamme de tissus [32]. GAPDH a été initialement identifié comme un intermédiaire dans la voie de la glycolyse et devrait être présent de manière stable dans toutes les cellules, il a donc été sélectionné comme gène de référence. Cependant, d'autres activités de GAPDH, y compris les fonctions d'endocytose, de contrôle de la traduction et de réplication de l'ADN [33], n'ont été reconnues que plus tard [32].

Divers gènes de référence ont été utilisés dans différentes études sur l'exercice. Mahoney et al. -[34] a rapporté que β-2-microglobuline (B2M) et ACTB étaient les gènes de référence les plus stables après 300 contractions excentriques, alors que B2M et GAPDH étaient les plus stables après 75 minutes de cyclisme intermittent à haute intensité. Dans une autre étude, des biopsies musculaires ont été prises avant, immédiatement après et 4 h après 30 min de course sur tapis roulant à 70 % de la VO2max, et l'ARN a été extrait de 40 fibres simples. GAPDH s'est avéré être exprimé de manière stable dans tous les échantillons [35]. Ainsi, lors de l'utilisation de gènes de référence comme contrôles internes pour une étude d'exercice, la stabilité de chaque gène de référence doit être évaluée avec soin, et il n'y a pas de gène unique qui peut être utilisé dans toutes les études et avec tous les protocoles d'exercice.

Afin de réduire la variabilité du contrôle interne, il est recommandé d'utiliser plusieurs gènes pour la normalisation [36, 37]. À l'aide d'échantillons obtenus à partir de lignées cellulaires de neuroblastomes, Vandesompele et ses collègues ont montré que la normalisation à l'aide d'un seul gène de référence entraînait des différences de 3,0 fois dans 25 % et de 6,4 fois dans 10 % des cas analysés [36]. L'évaluation des gènes de référence peut être réalisée en réalisant une analyse statistique sur le Cq valeur ou en utilisant les logiciels disponibles. Plusieurs logiciels sont disponibles pour l'évaluation des gènes de référence en utilisant différentes approches analytiques, tels que BestKeeper [38], NormFinder [39] et GeNorm [36].

Dans notre laboratoire, nous disposons de six gènes de référence couramment utilisés, ACTB, Protéine de liaison TATA-box (PAD), Cyclophiline, GAPDH, B2M, et ARNr 18S (Tableau 4). Il y a plusieurs raisons pour lesquelles ces gènes de référence candidats ont été choisis. Tout d'abord, ces six gènes sont des gènes de référence potentiellement exprimés de manière stable et sont largement utilisés dans l'analyse qPCR d'échantillons de muscles squelettiques obtenus dans des études d'exercice humain [34, 35, 40]. Deuxièmement, ils appartiennent à des classes fonctionnelles différentes, il est donc peu probable qu'ils soient co-régulés. Cependant, en utilisant le comparatif Cq méthode, il est difficile de qualifier de petites différences dans l'expression des gènes (c'est-à-dire moins de 2 fois) à moins que plusieurs gènes de référence exprimés de manière stable ne soient utilisés pour la normalisation [36, 41].

Tableau 4

GèneN° d'accessionFonction (base de données de séquences de référence NCBI [42])
ACTB (actine bêta) <"type":"entrez-nucleotide","attrs":<"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3">> NM_001101.3Ce gène code pour l'une des six protéines d'actine différentes, qui est un constituant majeur de l'appareil contractile et l'une des deux actines cytosquelettiques non musculaires.
TBP (protéine de liaison TATA-box) <"type":"entrez-nucleotide","attrs":<"text":"NM_003194.4","term_id":"285026518","term_text":"NM_003194.4">> NM_003194.4Ce gène code pour un facteur de transcription général qui se lie spécifiquement à une séquence d'ADN appelée boîte TATA et aide à positionner l'ARN polymérase II sur le site de début de transcription du gène.
Cyclophiline (PPIA, peptidyl-prolyl cis-trans isomérase A) <"type":"entrez-nucleotide","attrs":<"text":"NM_021130.4","term_id":"665821272","term_text":"NM_021130.4">> NM_021130.4Ce gène code pour une protéine qui catalyse l'isomérisation cis-trans des liaisons peptidiques imidiques de la proline dans les oligopeptides et accélère le repliement des protéines.
GAPDH (glycéraldéhyde-3-phosphate déshydrogénase) <"type":"entrez-nucleotide","attrs":<"text":"NM_001289746.1","term_id":"576583523","term_text":"NM_001289746.1">> NM_001289746.1Ce gène code pour une enzyme clé de la voie glycolytique, qui catalyse la phosphorylation oxydative réversible du glycéraldéhyde-3-phosphate en présence de phosphate inorganique et de nicotinamide adénine dinucléotide (NAD).
B2M (β-2-microglobuline) <"type":"entrez-nucleotide","attrs":<"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2">> NM_004048.2Ce gène code pour une protéine sérique en association avec la chaîne lourde de classe I du complexe majeur d'histocompatibilité (CMH) à la surface de presque toutes les cellules nucléées.
ARNr 18S (ARN, ribosomique 18S) <"type":"entrez-nucleotide","attrs":<"text":"NR_003286.2","term_id":"225637497","term_text":"NR_003286.2">> NR_003286.2Ce gène représente la partie d'une répétition d'ADNr qui code pour un ARNr 18S.

Expérience 4

Dans notre étude sur l'exercice humain (voir Matériel et méthodes), des échantillons musculaires ont été prélevés sur 9 participants au repos (Référence), puis immédiatement après (0 h) et 3 h après (3 h) la dernière séance d'entraînement d'une semaine de 4 intervention de formation. Tous les échantillons musculaires ont été congelés immédiatement après la biopsie musculaire, et l'ARN de tous les échantillons (n ​​= 27) a été extrait à l'aide du kit RNeasy Plus Universal Mini avec un protocole modifié (utilisant du 2-propanol) pour tous les échantillons, nous avons obtenu un UNE260/UNE280 ratio supérieur à 1,9 et un score RQI supérieur à 7 (en utilisant un système d'électrophorèse automatisé Experion). Nous avons ensuite effectué la transcription inverse pour convertir l'ARN en ADNc en un seul passage, avant de procéder à l'analyse qPCR. Pour trouver des gènes de référence exprimés de manière stable dans tous les échantillons à tous les moments, nous avons testé six gènes de référence (ACTB, PAD, Cyclophiline, GAPDH, B2M, et 18S ARNr tableau 5 et figure 7). Nous avons ensuite utilisé RefFinder pour évaluer la stabilité de ces gènes. RefFinder est un outil Web, capable d'exécuter simultanément quatre algorithmes bien établis (GeNorm [36], BestKeeper [38], NormFinder [39] et delta-CT comparatif [43]), d'attribuer un poids approprié à chacun. gène individuel et calculer la moyenne géométrique de leurs poids pour le classement final global [44]. Sur la base du classement complet recommandé de RefFlinder, nos gènes candidats ont été classés du plus au moins stable comme B2M, PAD, ARNr 18S, ACTB, GAPDH et Cyclophiline (Tableau 5).

Cq valeurs des réactions individuelles en utilisant ACTB, PAD, Cyclophiline, GAPDH, B2M, et ARNr 18S les amorces sont présentées. Tous les échantillons proviennent d'une étude sur l'exercice (n = 9 participants × 3 points dans le temps = 27 échantillons).

Tableau 5

Ordre de classement (du plus au moins stable)
Méthode123456
Delta CTPADB2MARNr 18SACTBGAPDHCyclophiline
Meilleur gardienB2MPADARNr 18SACTBGAPDHCyclophiline
Recherche de normesPADB2MARNr 18SACTBGAPDHCyclophiline
GenormARNr B2M / 18SPADACTBGAPDHCyclophiline
Classement complet recommandéB2MPADARNr 18SACTBGAPDHCyclophiline

Pour illustrer comment on pourrait procéder pour choisir des gènes de référence, nous choisissons Coactivateur PPRG 1 alpha (PGC-1α) comme exemple pour l'analyse de l'expression génique. PGC-1α est un coactivateur transcriptionnel enrichi en muscle squelettique. Il a été démontré que l'exercice est capable d'augmenter PGC-1α Teneur en ARNm chez l'homme [45]. L'efficacité d'amplification des six gènes de référence candidats était similaire à celle de notre gène cible, PGC-1α (Tableau 6). Nous avons utilisé la moyenne géométrique des trois gènes les mieux classés par RefFinder (PAD, B2M, et ARNr 18S) pour la normalisation ultérieure des données. Nos recommandations pour le choix des gènes de référence sont répertoriées dans l'encadré 10.

Tableau 6

GèneN° d'accessionAmorces (avant et arrière)Taille de l'amplicon (pb)Position de départ (pb)Efficacité (%)La source
TBP (protéine de liaison TATA-box) <"type":"entrez-nucleotide","attrs":<"text":"NM_003194.4","term_id":"285026518","term_text":"NM_003194.4">> NM_003194.4 F : CAGTGACCCAGCAGCATCACT
R : AGGCCAAGCCCTGAGCGTAA
20512199[46]
Cyclophiline (PPIA, peptidyl-prolyl cis-trans isomérase A) <"type":"entrez-nucleotide","attrs":<"text":"NM_021130.4","term_id":"665821272","term_text":"NM_021130.4">> NM_021130.4 F : GTCAACCCCACCGTTGTTCTTC
R : TTTCTGCTGTCTTTGGGACCTTG
10093100[47]
B2M (β-2-microglobuline) <"type":"entrez-nucleotide","attrs":<"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2">> NM_004048.2 F : TGCTGTCTCCATGTTTGATGTATCT
R : TCTCTGCTCCCCACCTCTAAGT
8658998[36]
ACTB (actine bêta) <"type":"entrez-nucleotide","attrs":<"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3">> NM_001101.3 F : GAGCACAGAGCCTCGCCTTT
R : TCATCATCCATGGTGAGCTGGGC
7026107Conçu par des auteurs
ARNr 18S (ARN, 18S ribosomique 5) <"type":"entrez-nucleotide","attrs":<"text":"NR_003286.2","term_id":"225637497","term_text":"NR_003286.2">> NR_003286.2 F : CTTAGAGGGACAAGTGGCG
R : GGACCTTAAGGGCATCACA
71144399[48]
GAPDH (glycéraldéhyde-3-phosphate déshydrogénase) <"type":"entrez-nucleotide","attrs":<"text":"NM_001289746.1","term_id":"576583523","term_text":"NM_001289746.1">> NM_001289746.1 F : AATCCCATCACCATCTTCCA
R : TGGACTCCACGACGTACTCA
82388106[49]
PGC-1α (PPARG coactivateur 1 alpha) <"type":"entrez-nucleotide","attrs":<"text":"NM_013261.3","term_id":"116284374","term_text":"NM_013261.3">> NM_013261.3 F : CAGCCTCTTTGCCCAGATCTT
R : TCACTGCACCACTTGAGTCCAC
101199104[50]

Encadré 10

Il est recommandé de tester plusieurs gènes de référence [36, 37], et la stabilité de chaque gène doit être évaluée avant de choisir les gènes de référence appropriés pour une étude particulière. Nous vous recommandons d'utiliser RefFinder pour évaluer la stabilité des gènes de référence, car il exécute simultanément quatre algorithmes bien établis. Outre la stabilité du gène de référence, l'efficacité d'amplification des gènes de référence doit être similaire à celle des gènes cibles.

C. Normaliser l'expression des gènes via la quantification de l'ADNc

Trouver des gènes de référence stables est un défi lors de la réalisation de qPCR, et les chercheurs ont recherché des méthodes alternatives telles que la quantification de l'ADNc. Le réactif Quant-iT ™ OliGreen ssDNA est un colorant d'acide nucléique fluorescent pour quantifier l'ADNc, et il a été utilisé dans de nombreux articles publiés, y compris des études portant sur l'expression des gènes dans le muscle squelettique humain en réponse à l'exercice [51�]. Un problème potentiel avec l'utilisation du colorant OliGreen pour quantifier la teneur en ADNc est que le colorant est également sensible à l'ARN, comme indiqué dans le manuel d'utilisation “le réactif OliGreen présente une amélioration de la fluorescence lorsqu'il est lié à l'ARN” [54].

Expérience 5

Pour tester la spécificité et la validité de l'utilisation du colorant OliGreen pour qualifier la teneur en ADNc, nous avons synthétisé de l'ADNc à partir de quatre quantités différentes (0, 0,25, 0,5 et 1 μg) d'ARN obtenu à partir de l'expérience 1 (‘Good Practice”, n = 4 pour chaque entrée d'ARN). Nous avons également chargé 1 ARN μg dans la réaction témoin –RT, qui ne contenait pas d'ADNc (n = 4). Nous avons utilisé iScript ™ Reverse Transcription Supermix (Bio-Rad) pour la synthèse d'ADNc. L'enzyme transcriptase inverse de ce kit a une activité RNase H + qui dégrade le brin d'ARN dans les hybrides ARN-ADN après la synthèse d'ADNc. La teneur en ADNc dans chaque échantillon a ensuite été mesurée en utilisant le colorant OliGreen (figure 8A). Conformément aux recherches précédentes [51], les échantillons d'ADNc synthétisés à partir de différentes quantités d'ARN ont montré une forte corrélation positive pour la concentration d'ADNc mesurée par rapport à l'entrée d'ARN (r = 0,9947, P< 0,0001) (figure 8B). Cependant, la réaction de contrôle -RT, qui ne contenait que 1 d'ARN mais pas d'ADNc, a montré une lecture plus élevée que l'ADNc synthétisé à partir de 0,5 &# 003bcg d'ARN. Ce résultat a confirmé que le colorant OliGreen ne mesure pas spécifiquement l'ADN simple brin, mais mesure également l'ARN. Cela pourrait entraîner une teneur en ADNc faussement élevée dans le test si l'ARN n'est pas dégradé correctement. Nos recommandations pour normaliser l'expression des gènes via la quantification de l'ADNc sont énumérées dans l'encadré 11.

A: Determination of cDNA amount in reactions with different RNA input. Different amounts of RNA were used to synthesise cDNA (n = 4 for each RNA input), and the relative amount of cDNA in each reaction was measured using OliGreen dye. Values are presented as mean ± SD. B: Correlation between RNA input and average relative amount of cDNA measured.

Box 11

In order to obtain an accurate and specific measurement of cDNA from the Oligreen dye, RNA in the RNA-DNA hybrids needs to be degraded before measurement. This can be achieved by using a reverse transcriptase enzyme with RNase H + activity ( Fig 8 ), or including an RNase degradation step after cDNA synthesis [51].

D. Effect of normalisation methods on the results

Experiment 6

To investigate how normalisation might alter the outcome, we measured the exercise-induced expression of PGC-1α mRNA in the samples from a human exercise study (as described in Experiment 4) and analysed the same set of data in three ways. We performed normalisation using three of the most stable reference genes (PAD, B2M, et ARNr 18S), based on the reference gene evaluation ( Table 5 ). In comparison, we also used a single reference gene, Cyclophilin, which was the lowest ranked reference gene. Lastly, we analysed the data using the cDNA content measured by Quant-iT ™ OliGreen ssDNA Reagent. We saw a significant difference in gene expression at 3 hours after exercise using all three normalisation options (P < 0.01, Fig 9 ). These exercise-induced fold changes in PGC-1α expression are consistent with the existing literature [40, 45].

Muscle samples were taken at rest (Baseline, Week 0) and immediately post-exercise (0 h), and 3 h post-exercise. Data were analysed using 3 different normalisation methods. Values are fold change ± SD.

There were no significant differences between the fold changes in PGC-1α mRNA content when using different methods of normalisation however, the fold changes were more similar when using three reference genes and cDNA content for normalisation, rather than using one reference gene. The increase of PGC-1α was 3.4 ± 2.0 fold when three reference genes were used for normalisation. When a single reference gene (Cyclophilin) was used for normalisation, the increase in gene expression was 5.1 ± 2.4 fold (P = 0.08 compared to 3 reference genes). When cDNA content was used for normalisation, the increase of gene expression was 3.2 ± 1.9 fold (P = 0.51 compared to 3 reference genes, P = 0.09 compared to 1 reference gene). In certain experimental settings, especially when examining small changes in mRNA level, these different results could lead to different conclusions. This may also help to explain the inter-study variability for exercise-induced changes in mRNA content. As previously suggested, use of a single reference gene is considered ‘not acceptable’ unless its stability has been clearly demonstrated in the same study [1]. Our recommendations for normalising gene expression via reference genes are listed in Box 12.

Box 12

We recommend testing four or more candidate reference genes for each study, and selecting the ones that are stably expressed for data normalisation. In our research laboratory, we chose to use two to three most stable reference genes based on evaluation software for an individual study [45, 55].


DNA provirus hypothesis

In the mid-20th century there were many advances in molecular biology, including the description of DNA in 1953 by American geneticist and biophysicist James D. Watson and British biophysicists Francis Crick and Maurice Wilkins. By the 1960s it was understood that sarcomas are caused by a mutation that results in uncontrolled cell division. It was also evident that RSV was inherited during the division of cancerous cells. This inheritance occurred in a manner agreeing with the Mendelian laws of genetic inheritance—laws that heretofore had been understood to apply only to DNA molecules (voir the articles genetics and heredity).

Scientists hypothesized that, in order for such viral inheritance to occur, a virus would need to transcribe its RNA genome into DNA and then insert this DNA into the host cell genome. Once incorporated into the host genome, the virus would be transcribed as though it were another gene and could produce more RNA virus from its DNA. This hypothesis, called the “DNA provirus hypothesis,” was developed in the late 1950s by American virologist Howard Martin Temin, when he was a postdoctoral fellow in the laboratory of Italian virologist Renato Dulbecco at the California Institute of Technology. Temin’s hypothesis was formally proposed in 1964. The provirus hypothesis came about when experiments demonstrated that an antibiotic called actinomycin D, which is capable of inhibiting DNA and RNA synthesis, inhibited the reproduction of RSV. However, the concept of an RNA molecule’s turning itself into DNA drew very few supporters.


Voir la vidéo: Superscript Vilo cDNA synthesis kit qPCR step 4 (Août 2022).